\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118204544:

Variant ID: vg0118204544 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 18204544
Reference Allele: CAlternative Allele: T,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.22, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


AACATGCGAGTTTTTTAAAGGAGATTTCTTATACGACTCTAACTATATTTCTAAAAGCGAAAGAACTTAAAAAACCGACCTAAATACGGATCTGTATTTT[C/T,A]
AAAAGTGAATGAGCTTAAAAGCCGACTCAAATACGGATGACGTAACAAAGTATCGATAAAAATATCTTTAATTTTTACAATAGTAGATATATGTTTGAAG

Reverse complement sequence

CTTCAAACATATATCTACTATTGTAAAAATTAAAGATATTTTTATCGATACTTTGTTACGTCATCCGTATTTGAGTCGGCTTTTAAGCTCATTCACTTTT[G/A,T]
AAAATACAGATCCGTATTTAGGTCGGTTTTTTAAGTTCTTTCGCTTTTAGAAATATAGTTAGAGTCGTATAAGAAATCTCCTTTAAAAAACTCGCATGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.00% 38.90% 0.13% 0.00% NA
All Indica  2759 95.00% 4.90% 0.04% 0.00% NA
All Japonica  1512 2.40% 97.20% 0.33% 0.00% NA
Aus  269 65.40% 34.60% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 85.40% 14.60% 0.00% 0.00% NA
Indica III  913 98.80% 1.10% 0.11% 0.00% NA
Indica Intermediate  786 93.00% 7.00% 0.00% 0.00% NA
Temperate Japonica  767 0.50% 99.00% 0.52% 0.00% NA
Tropical Japonica  504 5.60% 94.40% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.50% 0.41% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 45.60% 54.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0118204544 C -> T LOC_Os01g33090.1 upstream_gene_variant ; 633.0bp to feature; MODIFIER silent_mutation Average:57.065; most accessible tissue: Callus, score: 88.981 N N N N
vg0118204544 C -> T LOC_Os01g33080-LOC_Os01g33090 intergenic_region ; MODIFIER silent_mutation Average:57.065; most accessible tissue: Callus, score: 88.981 N N N N
vg0118204544 C -> A LOC_Os01g33090.1 upstream_gene_variant ; 633.0bp to feature; MODIFIER N Average:57.065; most accessible tissue: Callus, score: 88.981 N N N N
vg0118204544 C -> A LOC_Os01g33080-LOC_Os01g33090 intergenic_region ; MODIFIER N Average:57.065; most accessible tissue: Callus, score: 88.981 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0118204544 6.46E-07 NA mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118204544 7.53E-07 NA mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118204544 7.85E-07 NA mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118204544 5.76E-06 NA mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118204544 1.02E-07 NA mr1496 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118204544 NA 7.19E-17 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118204544 NA 6.27E-15 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118204544 NA 2.56E-20 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118204544 NA 2.19E-06 mr1711_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118204544 NA 9.87E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118204544 NA 3.30E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118204544 NA 1.58E-24 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251