\
| Variant ID: vg0118204544 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 18204544 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.22, others allele: 0.00, population size: 94. )
AACATGCGAGTTTTTTAAAGGAGATTTCTTATACGACTCTAACTATATTTCTAAAAGCGAAAGAACTTAAAAAACCGACCTAAATACGGATCTGTATTTT[C/T,A]
AAAAGTGAATGAGCTTAAAAGCCGACTCAAATACGGATGACGTAACAAAGTATCGATAAAAATATCTTTAATTTTTACAATAGTAGATATATGTTTGAAG
CTTCAAACATATATCTACTATTGTAAAAATTAAAGATATTTTTATCGATACTTTGTTACGTCATCCGTATTTGAGTCGGCTTTTAAGCTCATTCACTTTT[G/A,T]
AAAATACAGATCCGTATTTAGGTCGGTTTTTTAAGTTCTTTCGCTTTTAGAAATATAGTTAGAGTCGTATAAGAAATCTCCTTTAAAAAACTCGCATGTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.00% | 38.90% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 95.00% | 4.90% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 2.40% | 97.20% | 0.33% | 0.00% | NA |
| Aus | 269 | 65.40% | 34.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 93.00% | 7.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.50% | 99.00% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 54.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0118204544 | C -> T | LOC_Os01g33090.1 | upstream_gene_variant ; 633.0bp to feature; MODIFIER | silent_mutation | Average:57.065; most accessible tissue: Callus, score: 88.981 | N | N | N | N |
| vg0118204544 | C -> T | LOC_Os01g33080-LOC_Os01g33090 | intergenic_region ; MODIFIER | silent_mutation | Average:57.065; most accessible tissue: Callus, score: 88.981 | N | N | N | N |
| vg0118204544 | C -> A | LOC_Os01g33090.1 | upstream_gene_variant ; 633.0bp to feature; MODIFIER | N | Average:57.065; most accessible tissue: Callus, score: 88.981 | N | N | N | N |
| vg0118204544 | C -> A | LOC_Os01g33080-LOC_Os01g33090 | intergenic_region ; MODIFIER | N | Average:57.065; most accessible tissue: Callus, score: 88.981 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0118204544 | 6.46E-07 | NA | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118204544 | 7.53E-07 | NA | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118204544 | 7.85E-07 | NA | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118204544 | 5.76E-06 | NA | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118204544 | 1.02E-07 | NA | mr1496 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118204544 | NA | 7.19E-17 | mr1040_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118204544 | NA | 6.27E-15 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118204544 | NA | 2.56E-20 | mr1362_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118204544 | NA | 2.19E-06 | mr1711_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118204544 | NA | 9.87E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118204544 | NA | 3.30E-16 | mr1836_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118204544 | NA | 1.58E-24 | mr1916_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |