\
| Variant ID: vg0118115278 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 18115278 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGAAGATGAGATCTTCCTGATGATCAAATGACTTTGACGTTGGTAACCCTCCAAGTGAAGAATCAATATGGTGTGAAGGTACTCCTATTGGTATAACTTT[A/G]
CTTTTTAAATTTGAGTTTAGGATGCCGTACTATTAAGAGGGATACCACATGCATATAATTGGTTGAATACTAGTGCTCAAAATGCTTCATGTTTGTGTGA
TCACACAAACATGAAGCATTTTGAGCACTAGTATTCAACCAATTATATGCATGTGGTATCCCTCTTAATAGTACGGCATCCTAAACTCAAATTTAAAAAG[T/C]
AAAGTTATACCAATAGGAGTACCTTCACACCATATTGATTCTTCACTTGGAGGGTTACCAACGTCAAAGTCATTTGATCATCAGGAAGATCTCATCTTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.70% | 10.20% | 16.44% | 4.66% | NA |
| All Indica | 2759 | 75.70% | 1.10% | 17.72% | 5.55% | NA |
| All Japonica | 1512 | 55.00% | 29.40% | 12.57% | 3.04% | NA |
| Aus | 269 | 63.20% | 0.40% | 30.11% | 6.32% | NA |
| Indica I | 595 | 79.70% | 0.00% | 16.47% | 3.87% | NA |
| Indica II | 465 | 81.50% | 1.10% | 4.73% | 12.69% | NA |
| Indica III | 913 | 68.30% | 1.50% | 26.29% | 3.83% | NA |
| Indica Intermediate | 786 | 77.70% | 1.30% | 16.41% | 4.58% | NA |
| Temperate Japonica | 767 | 30.40% | 50.20% | 16.17% | 3.26% | NA |
| Tropical Japonica | 504 | 94.60% | 1.00% | 3.97% | 0.40% | NA |
| Japonica Intermediate | 241 | 50.20% | 22.80% | 19.09% | 7.88% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 3.12% | 2.08% | NA |
| Intermediate | 90 | 74.40% | 7.80% | 15.56% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0118115278 | A -> G | LOC_Os01g32980.1 | upstream_gene_variant ; 3930.0bp to feature; MODIFIER | silent_mutation | Average:19.35; most accessible tissue: Minghui63 root, score: 25.504 | N | N | N | N |
| vg0118115278 | A -> G | LOC_Os01g32990.1 | upstream_gene_variant ; 1534.0bp to feature; MODIFIER | silent_mutation | Average:19.35; most accessible tissue: Minghui63 root, score: 25.504 | N | N | N | N |
| vg0118115278 | A -> G | LOC_Os01g32980-LOC_Os01g32990 | intergenic_region ; MODIFIER | silent_mutation | Average:19.35; most accessible tissue: Minghui63 root, score: 25.504 | N | N | N | N |
| vg0118115278 | A -> DEL | N | N | silent_mutation | Average:19.35; most accessible tissue: Minghui63 root, score: 25.504 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0118115278 | NA | 1.37E-09 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0118115278 | NA | 2.07E-14 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0118115278 | NA | 2.98E-07 | mr1030 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | NA | 2.07E-07 | mr1040 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | NA | 1.34E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | NA | 3.51E-06 | mr1075 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | NA | 6.95E-07 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | 2.24E-06 | NA | mr1147 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | NA | 4.22E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | NA | 4.70E-07 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | NA | 3.95E-06 | mr1170 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | NA | 2.62E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | 8.22E-07 | NA | mr1202 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | 2.64E-06 | 1.59E-09 | mr1202 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | NA | 9.39E-07 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | NA | 2.88E-08 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | NA | 9.18E-07 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | NA | 4.41E-06 | mr1318 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | NA | 6.81E-06 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | 9.74E-06 | NA | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | NA | 4.87E-08 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | NA | 2.90E-07 | mr1555 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | NA | 6.21E-08 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | NA | 3.49E-06 | mr1576 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | NA | 6.25E-06 | mr1614 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | NA | 3.23E-07 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | NA | 7.08E-06 | mr1788 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | 1.76E-06 | NA | mr1789 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118115278 | NA | 5.01E-06 | mr1872 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |