\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118115278:

Variant ID: vg0118115278 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 18115278
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAAGATGAGATCTTCCTGATGATCAAATGACTTTGACGTTGGTAACCCTCCAAGTGAAGAATCAATATGGTGTGAAGGTACTCCTATTGGTATAACTTT[A/G]
CTTTTTAAATTTGAGTTTAGGATGCCGTACTATTAAGAGGGATACCACATGCATATAATTGGTTGAATACTAGTGCTCAAAATGCTTCATGTTTGTGTGA

Reverse complement sequence

TCACACAAACATGAAGCATTTTGAGCACTAGTATTCAACCAATTATATGCATGTGGTATCCCTCTTAATAGTACGGCATCCTAAACTCAAATTTAAAAAG[T/C]
AAAGTTATACCAATAGGAGTACCTTCACACCATATTGATTCTTCACTTGGAGGGTTACCAACGTCAAAGTCATTTGATCATCAGGAAGATCTCATCTTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.70% 10.20% 16.44% 4.66% NA
All Indica  2759 75.70% 1.10% 17.72% 5.55% NA
All Japonica  1512 55.00% 29.40% 12.57% 3.04% NA
Aus  269 63.20% 0.40% 30.11% 6.32% NA
Indica I  595 79.70% 0.00% 16.47% 3.87% NA
Indica II  465 81.50% 1.10% 4.73% 12.69% NA
Indica III  913 68.30% 1.50% 26.29% 3.83% NA
Indica Intermediate  786 77.70% 1.30% 16.41% 4.58% NA
Temperate Japonica  767 30.40% 50.20% 16.17% 3.26% NA
Tropical Japonica  504 94.60% 1.00% 3.97% 0.40% NA
Japonica Intermediate  241 50.20% 22.80% 19.09% 7.88% NA
VI/Aromatic  96 94.80% 0.00% 3.12% 2.08% NA
Intermediate  90 74.40% 7.80% 15.56% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0118115278 A -> G LOC_Os01g32980.1 upstream_gene_variant ; 3930.0bp to feature; MODIFIER silent_mutation Average:19.35; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0118115278 A -> G LOC_Os01g32990.1 upstream_gene_variant ; 1534.0bp to feature; MODIFIER silent_mutation Average:19.35; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0118115278 A -> G LOC_Os01g32980-LOC_Os01g32990 intergenic_region ; MODIFIER silent_mutation Average:19.35; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0118115278 A -> DEL N N silent_mutation Average:19.35; most accessible tissue: Minghui63 root, score: 25.504 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0118115278 NA 1.37E-09 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0118115278 NA 2.07E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0118115278 NA 2.98E-07 mr1030 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 NA 2.07E-07 mr1040 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 NA 1.34E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 NA 3.51E-06 mr1075 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 NA 6.95E-07 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 2.24E-06 NA mr1147 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 NA 4.22E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 NA 4.70E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 NA 3.95E-06 mr1170 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 NA 2.62E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 8.22E-07 NA mr1202 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 2.64E-06 1.59E-09 mr1202 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 NA 9.39E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 NA 2.88E-08 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 NA 9.18E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 NA 4.41E-06 mr1318 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 NA 6.81E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 9.74E-06 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 NA 4.87E-08 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 NA 2.90E-07 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 NA 6.21E-08 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 NA 3.49E-06 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 NA 6.25E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 NA 3.23E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 NA 7.08E-06 mr1788 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 1.76E-06 NA mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118115278 NA 5.01E-06 mr1872 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251