\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118083761:

Variant ID: vg0118083761 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 18083761
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.07, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


CTGGTGTCACCGCCTGCACGGCTGGCCTATTATGCCGCTGTTGTTGGGTGTCTATGTCTTCACCAACCGGCCGCCTTGTCCGCCGCCGACTAGTGTCTCC[G/A]
TCTGCACGGCTGGCCTATTATGCCGCCGTTGTCGGACGTCTACATCTTCACCGACCGGCCGCTTCATATGACGCCAATTGATGCTATCGTCTTCACGGCT

Reverse complement sequence

AGCCGTGAAGACGATAGCATCAATTGGCGTCATATGAAGCGGCCGGTCGGTGAAGATGTAGACGTCCGACAACGGCGGCATAATAGGCCAGCCGTGCAGA[C/T]
GGAGACACTAGTCGGCGGCGGACAAGGCGGCCGGTTGGTGAAGACATAGACACCCAACAACAGCGGCATAATAGGCCAGCCGTGCAGGCGGTGACACCAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.70% 39.20% 0.11% 0.00% NA
All Indica  2759 94.50% 5.30% 0.18% 0.00% NA
All Japonica  1512 2.60% 97.40% 0.00% 0.00% NA
Aus  269 65.10% 34.90% 0.00% 0.00% NA
Indica I  595 99.20% 0.50% 0.34% 0.00% NA
Indica II  465 84.70% 14.80% 0.43% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 92.10% 7.80% 0.13% 0.00% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 5.20% 94.80% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 43.30% 56.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0118083761 G -> A LOC_Os01g32940.1 upstream_gene_variant ; 3461.0bp to feature; MODIFIER silent_mutation Average:62.305; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N
vg0118083761 G -> A LOC_Os01g32950.1 upstream_gene_variant ; 2469.0bp to feature; MODIFIER silent_mutation Average:62.305; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N
vg0118083761 G -> A LOC_Os01g32964.1 downstream_gene_variant ; 3840.0bp to feature; MODIFIER silent_mutation Average:62.305; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N
vg0118083761 G -> A LOC_Os01g32950-LOC_Os01g32964 intergenic_region ; MODIFIER silent_mutation Average:62.305; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0118083761 NA 1.77E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118083761 NA 1.07E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118083761 1.27E-06 NA mr1718 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118083761 NA 3.97E-17 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118083761 NA 4.04E-20 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118083761 NA 4.23E-19 mr1581_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118083761 NA 7.07E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118083761 NA 1.77E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118083761 NA 2.90E-24 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251