Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0118083761:

Variant ID: vg0118083761 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 18083761
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.07, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

CTGGTGTCACCGCCTGCACGGCTGGCCTATTATGCCGCTGTTGTTGGGTGTCTATGTCTTCACCAACCGGCCGCCTTGTCCGCCGCCGACTAGTGTCTCC[G/A]
TCTGCACGGCTGGCCTATTATGCCGCCGTTGTCGGACGTCTACATCTTCACCGACCGGCCGCTTCATATGACGCCAATTGATGCTATCGTCTTCACGGCT

Reverse complement sequence

AGCCGTGAAGACGATAGCATCAATTGGCGTCATATGAAGCGGCCGGTCGGTGAAGATGTAGACGTCCGACAACGGCGGCATAATAGGCCAGCCGTGCAGA[C/T]
GGAGACACTAGTCGGCGGCGGACAAGGCGGCCGGTTGGTGAAGACATAGACACCCAACAACAGCGGCATAATAGGCCAGCCGTGCAGGCGGTGACACCAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.70%	39.20%	0.11%	0.00%	NA
All Indica	2759	94.50%	5.30%	0.18%	0.00%	NA
All Japonica	1512	2.60%	97.40%	0.00%	0.00%	NA
Aus	269	65.10%	34.90%	0.00%	0.00%	NA
Indica I	595	99.20%	0.50%	0.34%	0.00%	NA
Indica II	465	84.70%	14.80%	0.43%	0.00%	NA
Indica III	913	98.60%	1.40%	0.00%	0.00%	NA
Indica Intermediate	786	92.10%	7.80%	0.13%	0.00%	NA
Temperate Japonica	767	1.00%	99.00%	0.00%	0.00%	NA
Tropical Japonica	504	5.20%	94.80%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	43.30%	56.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0118083761	G -> A	LOC_Os01g32940.1	upstream_gene_variant ; 3461.0bp to feature; MODIFIER	silent_mutation	Average:62.305; most accessible tissue: Zhenshan97 flag leaf, score: 79.481	N	N	N	N
vg0118083761	G -> A	LOC_Os01g32950.1	upstream_gene_variant ; 2469.0bp to feature; MODIFIER	silent_mutation	Average:62.305; most accessible tissue: Zhenshan97 flag leaf, score: 79.481	N	N	N	N
vg0118083761	G -> A	LOC_Os01g32964.1	downstream_gene_variant ; 3840.0bp to feature; MODIFIER	silent_mutation	Average:62.305; most accessible tissue: Zhenshan97 flag leaf, score: 79.481	N	N	N	N
vg0118083761	G -> A	LOC_Os01g32950-LOC_Os01g32964	intergenic_region ; MODIFIER	silent_mutation	Average:62.305; most accessible tissue: Zhenshan97 flag leaf, score: 79.481	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0118083761	NA	1.77E-07	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118083761	NA	1.07E-17	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118083761	1.27E-06	NA	mr1718	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118083761	NA	3.97E-17	mr1040_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118083761	NA	4.04E-20	mr1362_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118083761	NA	4.23E-19	mr1581_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118083761	NA	7.07E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118083761	NA	1.77E-16	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118083761	NA	2.90E-24	mr1916_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251