\
| Variant ID: vg0118083761 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 18083761 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.07, others allele: 0.00, population size: 108. )
CTGGTGTCACCGCCTGCACGGCTGGCCTATTATGCCGCTGTTGTTGGGTGTCTATGTCTTCACCAACCGGCCGCCTTGTCCGCCGCCGACTAGTGTCTCC[G/A]
TCTGCACGGCTGGCCTATTATGCCGCCGTTGTCGGACGTCTACATCTTCACCGACCGGCCGCTTCATATGACGCCAATTGATGCTATCGTCTTCACGGCT
AGCCGTGAAGACGATAGCATCAATTGGCGTCATATGAAGCGGCCGGTCGGTGAAGATGTAGACGTCCGACAACGGCGGCATAATAGGCCAGCCGTGCAGA[C/T]
GGAGACACTAGTCGGCGGCGGACAAGGCGGCCGGTTGGTGAAGACATAGACACCCAACAACAGCGGCATAATAGGCCAGCCGTGCAGGCGGTGACACCAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.70% | 39.20% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 94.50% | 5.30% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 65.10% | 34.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 84.70% | 14.80% | 0.43% | 0.00% | NA |
| Indica III | 913 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.10% | 7.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 56.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0118083761 | G -> A | LOC_Os01g32940.1 | upstream_gene_variant ; 3461.0bp to feature; MODIFIER | silent_mutation | Average:62.305; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 | N | N | N | N |
| vg0118083761 | G -> A | LOC_Os01g32950.1 | upstream_gene_variant ; 2469.0bp to feature; MODIFIER | silent_mutation | Average:62.305; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 | N | N | N | N |
| vg0118083761 | G -> A | LOC_Os01g32964.1 | downstream_gene_variant ; 3840.0bp to feature; MODIFIER | silent_mutation | Average:62.305; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 | N | N | N | N |
| vg0118083761 | G -> A | LOC_Os01g32950-LOC_Os01g32964 | intergenic_region ; MODIFIER | silent_mutation | Average:62.305; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0118083761 | NA | 1.77E-07 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118083761 | NA | 1.07E-17 | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118083761 | 1.27E-06 | NA | mr1718 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118083761 | NA | 3.97E-17 | mr1040_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118083761 | NA | 4.04E-20 | mr1362_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118083761 | NA | 4.23E-19 | mr1581_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118083761 | NA | 7.07E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118083761 | NA | 1.77E-16 | mr1836_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118083761 | NA | 2.90E-24 | mr1916_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |