Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0118080333:

Variant ID: vg0118080333 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 18080333
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACCGCCGGCCGCCACGCCGCCGCCGGATCTGTGGCCTCCACCACCGCCGCTCCATCGCCATCGCCATTCCCGCCGGCCATCACCCACAACTCCACCCAG[C/T]
GCAACTCACCTCGACCGCCTCCATCACCCGTCCCCACCGCCACCGTCCTTGCGGCCGCGCGGCTTTGCCGGCGGTGTGGAGATTGTGGGTACCCAATACC

Reverse complement sequence

GGTATTGGGTACCCACAATCTCCACACCGCCGGCAAAGCCGCGCGGCCGCAAGGACGGTGGCGGTGGGGACGGGTGATGGAGGCGGTCGAGGTGAGTTGC[G/A]
CTGGGTGGAGTTGTGGGTGATGGCCGGCGGGAATGGCGATGGCGATGGAGCGGCGGTGGTGGAGGCCACAGATCCGGCGGCGGCGTGGCGGCCGGCGGTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.40%	2.30%	0.51%	0.70%	NA
All Indica	2759	98.00%	0.10%	0.69%	1.20%	NA
All Japonica	1512	92.90%	7.00%	0.07%	0.00%	NA
Aus	269	98.10%	0.70%	1.12%	0.00%	NA
Indica I	595	99.50%	0.20%	0.17%	0.17%	NA
Indica II	465	92.70%	0.00%	1.94%	5.38%	NA
Indica III	913	99.60%	0.00%	0.44%	0.00%	NA
Indica Intermediate	786	98.30%	0.10%	0.64%	0.89%	NA
Temperate Japonica	767	95.70%	4.20%	0.13%	0.00%	NA
Tropical Japonica	504	98.20%	1.80%	0.00%	0.00%	NA
Japonica Intermediate	241	73.00%	27.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	1.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0118080333	C -> T	LOC_Os01g32940.1	upstream_gene_variant ; 33.0bp to feature; MODIFIER	silent_mutation	Average:69.936; most accessible tissue: Zhenshan97 young leaf, score: 84.235	N	N	N	N
vg0118080333	C -> T	LOC_Os01g32930.1	downstream_gene_variant ; 2148.0bp to feature; MODIFIER	silent_mutation	Average:69.936; most accessible tissue: Zhenshan97 young leaf, score: 84.235	N	N	N	N
vg0118080333	C -> T	LOC_Os01g32950.1	downstream_gene_variant ; 690.0bp to feature; MODIFIER	silent_mutation	Average:69.936; most accessible tissue: Zhenshan97 young leaf, score: 84.235	N	N	N	N
vg0118080333	C -> T	LOC_Os01g32940-LOC_Os01g32950	intergenic_region ; MODIFIER	silent_mutation	Average:69.936; most accessible tissue: Zhenshan97 young leaf, score: 84.235	N	N	N	N
vg0118080333	C -> DEL	N	N	silent_mutation	Average:69.936; most accessible tissue: Zhenshan97 young leaf, score: 84.235	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0118080333	1.39E-08	1.39E-08	mr1008	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118080333	1.22E-08	1.22E-08	mr1009	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118080333	2.95E-07	2.95E-07	mr1200	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118080333	NA	4.24E-07	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251