\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118067123:

Variant ID: vg0118067123 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 18067123
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGATAGTTTCCAATAGTTGTTTCTACTAGTTTCTAAGCCTAGCTATGTCTTGCATGCATATACAATATACATATTGTCTTGTGGACAAAGAAAGCTAG[C/A]
TAGGAGGCAGGAAAAGGAAGGAAACAAGCTACACACATGAGCTACCTTTTGTACATGTACCAAACAGATCTCCCAGGGTTTTGGTTAAACTCAAGGTTAT

Reverse complement sequence

ATAACCTTGAGTTTAACCAAAACCCTGGGAGATCTGTTTGGTACATGTACAAAAGGTAGCTCATGTGTGTAGCTTGTTTCCTTCCTTTTCCTGCCTCCTA[G/T]
CTAGCTTTCTTTGTCCACAAGACAATATGTATATTGTATATGCATGCAAGACATAGCTAGGCTTAGAAACTAGTAGAAACAACTATTGGAAACTATCAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.80% 0.80% 0.40% 0.00% NA
All Indica  2759 98.00% 1.30% 0.65% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 94.60% 3.20% 2.18% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 1.70% 0.64% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0118067123 C -> A LOC_Os01g32890.1 upstream_gene_variant ; 3148.0bp to feature; MODIFIER silent_mutation Average:58.238; most accessible tissue: Callus, score: 91.034 N N N N
vg0118067123 C -> A LOC_Os01g32900.1 downstream_gene_variant ; 1320.0bp to feature; MODIFIER silent_mutation Average:58.238; most accessible tissue: Callus, score: 91.034 N N N N
vg0118067123 C -> A LOC_Os01g32910.1 downstream_gene_variant ; 1684.0bp to feature; MODIFIER silent_mutation Average:58.238; most accessible tissue: Callus, score: 91.034 N N N N
vg0118067123 C -> A LOC_Os01g32900-LOC_Os01g32910 intergenic_region ; MODIFIER silent_mutation Average:58.238; most accessible tissue: Callus, score: 91.034 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0118067123 NA 3.00E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118067123 NA 5.60E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118067123 2.89E-06 2.89E-06 mr1249 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118067123 NA 4.07E-07 mr1636 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118067123 NA 9.91E-11 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118067123 NA 5.29E-06 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118067123 7.31E-06 7.31E-06 mr1985 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251