\
| Variant ID: vg0118067123 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 18067123 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )
CTTGATAGTTTCCAATAGTTGTTTCTACTAGTTTCTAAGCCTAGCTATGTCTTGCATGCATATACAATATACATATTGTCTTGTGGACAAAGAAAGCTAG[C/A]
TAGGAGGCAGGAAAAGGAAGGAAACAAGCTACACACATGAGCTACCTTTTGTACATGTACCAAACAGATCTCCCAGGGTTTTGGTTAAACTCAAGGTTAT
ATAACCTTGAGTTTAACCAAAACCCTGGGAGATCTGTTTGGTACATGTACAAAAGGTAGCTCATGTGTGTAGCTTGTTTCCTTCCTTTTCCTGCCTCCTA[G/T]
CTAGCTTTCTTTGTCCACAAGACAATATGTATATTGTATATGCATGCAAGACATAGCTAGGCTTAGAAACTAGTAGAAACAACTATTGGAAACTATCAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.80% | 0.80% | 0.40% | 0.00% | NA |
| All Indica | 2759 | 98.00% | 1.30% | 0.65% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 94.60% | 3.20% | 2.18% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 1.70% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0118067123 | C -> A | LOC_Os01g32890.1 | upstream_gene_variant ; 3148.0bp to feature; MODIFIER | silent_mutation | Average:58.238; most accessible tissue: Callus, score: 91.034 | N | N | N | N |
| vg0118067123 | C -> A | LOC_Os01g32900.1 | downstream_gene_variant ; 1320.0bp to feature; MODIFIER | silent_mutation | Average:58.238; most accessible tissue: Callus, score: 91.034 | N | N | N | N |
| vg0118067123 | C -> A | LOC_Os01g32910.1 | downstream_gene_variant ; 1684.0bp to feature; MODIFIER | silent_mutation | Average:58.238; most accessible tissue: Callus, score: 91.034 | N | N | N | N |
| vg0118067123 | C -> A | LOC_Os01g32900-LOC_Os01g32910 | intergenic_region ; MODIFIER | silent_mutation | Average:58.238; most accessible tissue: Callus, score: 91.034 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0118067123 | NA | 3.00E-06 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118067123 | NA | 5.60E-06 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118067123 | 2.89E-06 | 2.89E-06 | mr1249 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118067123 | NA | 4.07E-07 | mr1636 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118067123 | NA | 9.91E-11 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118067123 | NA | 5.29E-06 | mr1839 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118067123 | 7.31E-06 | 7.31E-06 | mr1985 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |