\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118034244:

Variant ID: vg0118034244 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 18034244
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


ATGAGTAAAATAAGCAAGGATAAGTAAATCTAGCATCATTTTAATTTATGGACAGCAAGTATATAATTCTGAAATGTATAAGCAAATGAGCCCAAACGGC[G/A]
CTCTCATCATCATCCATGGACTACCAAAGTCCATACCAACATGGCACAACATGCCAACACCACCATCAAGCATAATCACATCCATAATAATCCACATTTG

Reverse complement sequence

CAAATGTGGATTATTATGGATGTGATTATGCTTGATGGTGGTGTTGGCATGTTGTGCCATGTTGGTATGGACTTTGGTAGTCCATGGATGATGATGAGAG[C/T]
GCCGTTTGGGCTCATTTGCTTATACATTTCAGAATTATATACTTGCTGTCCATAAATTAAAATGATGCTAGATTTACTTATCCTTGCTTATTTTACTCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.10% 0.90% 2.98% 4.04% NA
All Indica  2759 91.00% 1.20% 3.99% 3.81% NA
All Japonica  1512 99.30% 0.00% 0.13% 0.53% NA
Aus  269 58.40% 3.00% 10.41% 28.25% NA
Indica I  595 93.10% 0.20% 3.36% 3.36% NA
Indica II  465 98.50% 0.00% 1.29% 0.22% NA
Indica III  913 85.80% 2.80% 5.70% 5.70% NA
Indica Intermediate  786 91.10% 0.80% 4.07% 4.07% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 98.20% 0.00% 0.20% 1.59% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 2.20% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0118034244 G -> A LOC_Os01g32849.1 upstream_gene_variant ; 3855.0bp to feature; MODIFIER silent_mutation Average:42.774; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0118034244 G -> A LOC_Os01g32860.1 upstream_gene_variant ; 1627.0bp to feature; MODIFIER silent_mutation Average:42.774; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0118034244 G -> A LOC_Os01g32864.1 intron_variant ; MODIFIER silent_mutation Average:42.774; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0118034244 G -> DEL N N silent_mutation Average:42.774; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0118034244 6.73E-06 NA mr1484 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118034244 1.27E-07 5.64E-07 mr1745 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251