\
| Variant ID: vg0118023767 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 18023767 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.00, others allele: 0.00, population size: 232. )
AAAACTAGAGCTTCACATAGACAGATACCTAATTTGTTGTCACTGGTAAGCATGTTGTCGTTAGAGGATTTTACAGTTTTCTGAAGTTTGTAATTAATTC[G/A]
GTTCCTTTTTAATGGGTTTCTCATTGAAATCGAGAGGGAAAGAACCAAACAAGCAAACAATTGAAATTAAAAGTAAGCTTGTTTTCTGCTTCACTTCATC
GATGAAGTGAAGCAGAAAACAAGCTTACTTTTAATTTCAATTGTTTGCTTGTTTGGTTCTTTCCCTCTCGATTTCAATGAGAAACCCATTAAAAAGGAAC[C/T]
GAATTAATTACAAACTTCAGAAAACTGTAAAATCCTCTAACGACAACATGCTTACCAGTGACAACAAATTAGGTATCTGTCTATGTGAAGCTCTAGTTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.90% | 34.50% | 0.36% | 12.21% | NA |
| All Indica | 2759 | 76.70% | 2.20% | 0.58% | 20.48% | NA |
| All Japonica | 1512 | 9.50% | 90.30% | 0.00% | 0.20% | NA |
| Aus | 269 | 75.10% | 24.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 52.60% | 0.70% | 0.84% | 45.88% | NA |
| Indica II | 465 | 68.00% | 4.50% | 0.86% | 26.67% | NA |
| Indica III | 913 | 97.60% | 0.40% | 0.00% | 1.97% | NA |
| Indica Intermediate | 786 | 76.00% | 4.10% | 0.89% | 19.08% | NA |
| Temperate Japonica | 767 | 5.30% | 94.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 6.50% | 93.10% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 29.00% | 70.50% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 36.70% | 52.20% | 1.11% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0118023767 | G -> A | LOC_Os01g32849.1 | downstream_gene_variant ; 2737.0bp to feature; MODIFIER | silent_mutation | Average:34.465; most accessible tissue: Callus, score: 68.73 | N | N | N | N |
| vg0118023767 | G -> A | LOC_Os01g32840.1 | intron_variant ; MODIFIER | silent_mutation | Average:34.465; most accessible tissue: Callus, score: 68.73 | N | N | N | N |
| vg0118023767 | G -> DEL | N | N | silent_mutation | Average:34.465; most accessible tissue: Callus, score: 68.73 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0118023767 | NA | 1.59E-15 | mr1228 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118023767 | NA | 3.11E-19 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118023767 | NA | 3.97E-28 | mr1298 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118023767 | NA | 2.19E-51 | mr1519 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118023767 | NA | 1.31E-20 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118023767 | 3.15E-06 | 2.84E-07 | mr1719 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118023767 | NA | 2.38E-17 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118023767 | 5.06E-06 | 1.87E-54 | mr1519_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118023767 | NA | 1.93E-06 | mr1519_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118023767 | NA | 6.32E-22 | mr1698_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118023767 | NA | 6.92E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |