\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0117972404:

Variant ID: vg0117972404 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 17972404
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, G: 0.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TCAGAGTAACATATTGGCCCTTATCCTCCCAGGAACTCCAGTTAAAAAGAGGGATGGTAAGACTATACTCTTTAACCTAGAGAGGAGGCAGAGTGCAAGG[G/C]
TGAGGGCTTCTTCTGAAAGTTATCTTGAGCAAGATCCAAGAATGGGTATTGGAAAGCCTAGGGGAATGTCGGCCAAAAAACTTAAGGAACTAGTAGGTAT

Reverse complement sequence

ATACCTACTAGTTCCTTAAGTTTTTTGGCCGACATTCCCCTAGGCTTTCCAATACCCATTCTTGGATCTTGCTCAAGATAACTTTCAGAAGAAGCCCTCA[C/G]
CCTTGCACTCTGCCTCCTCTCTAGGTTAAAGAGTATAGTCTTACCATCCCTCTTTTTAACTGGAGTTCCTGGGAGGATAAGGGCCAATATGTTACTCTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.70% 36.20% 0.13% 0.00% NA
All Indica  2759 97.80% 2.00% 0.18% 0.00% NA
All Japonica  1512 4.60% 95.40% 0.07% 0.00% NA
Aus  269 70.30% 29.70% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 99.30% 0.40% 0.22% 0.00% NA
Indica Intermediate  786 95.40% 4.20% 0.38% 0.00% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 6.30% 93.70% 0.00% 0.00% NA
Japonica Intermediate  241 11.20% 88.40% 0.41% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 52.20% 47.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0117972404 G -> C LOC_Os01g32750.1 upstream_gene_variant ; 3802.0bp to feature; MODIFIER silent_mutation Average:47.158; most accessible tissue: Zhenshan97 young leaf, score: 69.263 N N N N
vg0117972404 G -> C LOC_Os01g32760.1 upstream_gene_variant ; 720.0bp to feature; MODIFIER silent_mutation Average:47.158; most accessible tissue: Zhenshan97 young leaf, score: 69.263 N N N N
vg0117972404 G -> C LOC_Os01g32770.1 downstream_gene_variant ; 3412.0bp to feature; MODIFIER silent_mutation Average:47.158; most accessible tissue: Zhenshan97 young leaf, score: 69.263 N N N N
vg0117972404 G -> C LOC_Os01g32760-LOC_Os01g32770 intergenic_region ; MODIFIER silent_mutation Average:47.158; most accessible tissue: Zhenshan97 young leaf, score: 69.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0117972404 NA 3.10E-16 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117972404 NA 1.98E-28 mr1298 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117972404 NA 3.52E-54 mr1519 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117972404 NA 4.87E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117972404 NA 1.83E-71 mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117972404 NA 2.02E-53 mr1200_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117972404 NA 1.43E-07 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117972404 NA 1.60E-09 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117972404 2.16E-08 3.63E-56 mr1519_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117972404 NA 2.82E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117972404 NA 1.32E-23 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117972404 NA 6.78E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117972404 NA 8.55E-14 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117972404 NA 1.10E-24 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251