Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0117841331:

Variant ID: vg0117841331 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 17841331
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

TTGCCCGAGACGACATACGAAGCAAAGCAGGTTCTGTGTCCACTGGGGTTATATAGAGGTCTGTAGAATTCACGCTTGTCCAAACAACTGCATATTGTAC[C/T]
ACAAGCAATATGCGGACTTGGATGCTTGTCCTGTCTGCAAGGCTTCTCGATACAAGCGAAAGAAAAGTGTTGACGAAGGAAAGAAGTCAAAGAGGGGTGG

Reverse complement sequence

CCACCCCTCTTTGACTTCTTTCCTTCGTCAACACTTTTCTTTCGCTTGTATCGAGAAGCCTTGCAGACAGGACAAGCATCCAAGTCCGCATATTGCTTGT[G/A]
GTACAATATGCAGTTGTTTGGACAAGCGTGAATTCTACAGACCTCTATATAACCCCAGTGGACACAGAACCTGCTTTGCTTCGTATGTCGTCTCGGGCAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.90%	2.20%	0.89%	0.00%	NA
All Indica	2759	95.80%	3.10%	1.12%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	91.10%	5.20%	3.72%	0.00%	NA
Indica I	595	93.90%	3.20%	2.86%	0.00%	NA
Indica II	465	99.10%	0.60%	0.22%	0.00%	NA
Indica III	913	95.60%	4.20%	0.22%	0.00%	NA
Indica Intermediate	786	95.40%	3.20%	1.40%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	95.60%	3.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0117841331	C -> T	LOC_Os01g32530.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:36.379; most accessible tissue: Minghui63 young leaf, score: 49.581	N	N	N	N
vg0117841331	C -> T	LOC_Os01g32520.1	upstream_gene_variant ; 3865.0bp to feature; MODIFIER	silent_mutation	Average:36.379; most accessible tissue: Minghui63 young leaf, score: 49.581	N	N	N	N
vg0117841331	C -> T	LOC_Os01g32540.1	downstream_gene_variant ; 4907.0bp to feature; MODIFIER	silent_mutation	Average:36.379; most accessible tissue: Minghui63 young leaf, score: 49.581	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0117841331	NA	6.94E-06	mr1280	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117841331	NA	2.99E-06	mr1330	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117841331	NA	7.40E-06	mr1636	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117841331	NA	7.81E-06	mr1729	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117841331	NA	2.19E-07	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117841331	NA	3.12E-06	mr1788	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117841331	NA	5.07E-07	mr1839	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117841331	NA	2.20E-06	mr1901	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117841331	3.78E-06	3.78E-06	mr1985	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251