\
| Variant ID: vg0117841331 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 17841331 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )
TTGCCCGAGACGACATACGAAGCAAAGCAGGTTCTGTGTCCACTGGGGTTATATAGAGGTCTGTAGAATTCACGCTTGTCCAAACAACTGCATATTGTAC[C/T]
ACAAGCAATATGCGGACTTGGATGCTTGTCCTGTCTGCAAGGCTTCTCGATACAAGCGAAAGAAAAGTGTTGACGAAGGAAAGAAGTCAAAGAGGGGTGG
CCACCCCTCTTTGACTTCTTTCCTTCGTCAACACTTTTCTTTCGCTTGTATCGAGAAGCCTTGCAGACAGGACAAGCATCCAAGTCCGCATATTGCTTGT[G/A]
GTACAATATGCAGTTGTTTGGACAAGCGTGAATTCTACAGACCTCTATATAACCCCAGTGGACACAGAACCTGCTTTGCTTCGTATGTCGTCTCGGGCAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.90% | 2.20% | 0.89% | 0.00% | NA |
| All Indica | 2759 | 95.80% | 3.10% | 1.12% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 91.10% | 5.20% | 3.72% | 0.00% | NA |
| Indica I | 595 | 93.90% | 3.20% | 2.86% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 95.60% | 4.20% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 95.40% | 3.20% | 1.40% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0117841331 | C -> T | LOC_Os01g32530.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:36.379; most accessible tissue: Minghui63 young leaf, score: 49.581 | N | N | N | N |
| vg0117841331 | C -> T | LOC_Os01g32520.1 | upstream_gene_variant ; 3865.0bp to feature; MODIFIER | silent_mutation | Average:36.379; most accessible tissue: Minghui63 young leaf, score: 49.581 | N | N | N | N |
| vg0117841331 | C -> T | LOC_Os01g32540.1 | downstream_gene_variant ; 4907.0bp to feature; MODIFIER | silent_mutation | Average:36.379; most accessible tissue: Minghui63 young leaf, score: 49.581 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0117841331 | NA | 6.94E-06 | mr1280 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117841331 | NA | 2.99E-06 | mr1330 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117841331 | NA | 7.40E-06 | mr1636 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117841331 | NA | 7.81E-06 | mr1729 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117841331 | NA | 2.19E-07 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117841331 | NA | 3.12E-06 | mr1788 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117841331 | NA | 5.07E-07 | mr1839 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117841331 | NA | 2.20E-06 | mr1901 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117841331 | 3.78E-06 | 3.78E-06 | mr1985 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |