\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0117840935:

Variant ID: vg0117840935 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 17840935
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


AAGGGCTATACATGTTGGGTGAAGCATGGAGAGTAAGAATCAGGAAGTGGAGCAGCAGCAGACAGAAGTGGTGCACATAATCAGGAAGATGAAGATGAGC[A/T]
TGACATGTTTATACCTTCTCCATTGGGCGGTGAAATGGTTGATGTGGATCACGATCTGCTGCAAGACATGTTACGTGACGTTGAGGACCCAGCCCAGAAT

Reverse complement sequence

ATTCTGGGCTGGGTCCTCAACGTCACGTAACATGTCTTGCAGCAGATCGTGATCCACATCAACCATTTCACCGCCCAATGGAGAAGGTATAAACATGTCA[T/A]
GCTCATCTTCATCTTCCTGATTATGTGCACCACTTCTGTCTGCTGCTGCTCCACTTCCTGATTCTTACTCTCCATGCTTCACCCAACATGTATAGCCCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.00% 31.50% 11.85% 11.70% NA
All Indica  2759 13.30% 50.30% 18.74% 17.69% NA
All Japonica  1512 97.40% 2.20% 0.13% 0.20% NA
Aus  269 52.80% 17.80% 10.04% 19.33% NA
Indica I  595 6.70% 37.50% 33.61% 22.18% NA
Indica II  465 21.70% 47.10% 17.42% 13.76% NA
Indica III  913 9.10% 66.90% 8.00% 15.99% NA
Indica Intermediate  786 18.20% 42.50% 20.74% 18.58% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 94.60% 4.80% 0.20% 0.40% NA
Japonica Intermediate  241 97.90% 1.20% 0.41% 0.41% NA
VI/Aromatic  96 95.80% 1.00% 0.00% 3.12% NA
Intermediate  90 57.80% 18.90% 15.56% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0117840935 A -> T LOC_Os01g32520.1 upstream_gene_variant ; 3469.0bp to feature; MODIFIER silent_mutation Average:26.451; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N
vg0117840935 A -> T LOC_Os01g32530.1 upstream_gene_variant ; 35.0bp to feature; MODIFIER silent_mutation Average:26.451; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N
vg0117840935 A -> T LOC_Os01g32520-LOC_Os01g32530 intergenic_region ; MODIFIER silent_mutation Average:26.451; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N
vg0117840935 A -> DEL N N silent_mutation Average:26.451; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0117840935 NA 5.03E-07 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117840935 7.98E-06 NA mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117840935 2.00E-06 NA mr1318_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117840935 NA 6.74E-07 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117840935 NA 1.36E-06 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117840935 4.51E-06 NA mr1746_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117840935 9.79E-06 NA mr1788_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117840935 1.72E-07 2.60E-08 mr1871_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251