\
| Variant ID: vg0117840935 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 17840935 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 300. )
AAGGGCTATACATGTTGGGTGAAGCATGGAGAGTAAGAATCAGGAAGTGGAGCAGCAGCAGACAGAAGTGGTGCACATAATCAGGAAGATGAAGATGAGC[A/T]
TGACATGTTTATACCTTCTCCATTGGGCGGTGAAATGGTTGATGTGGATCACGATCTGCTGCAAGACATGTTACGTGACGTTGAGGACCCAGCCCAGAAT
ATTCTGGGCTGGGTCCTCAACGTCACGTAACATGTCTTGCAGCAGATCGTGATCCACATCAACCATTTCACCGCCCAATGGAGAAGGTATAAACATGTCA[T/A]
GCTCATCTTCATCTTCCTGATTATGTGCACCACTTCTGTCTGCTGCTGCTCCACTTCCTGATTCTTACTCTCCATGCTTCACCCAACATGTATAGCCCTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.00% | 31.50% | 11.85% | 11.70% | NA |
| All Indica | 2759 | 13.30% | 50.30% | 18.74% | 17.69% | NA |
| All Japonica | 1512 | 97.40% | 2.20% | 0.13% | 0.20% | NA |
| Aus | 269 | 52.80% | 17.80% | 10.04% | 19.33% | NA |
| Indica I | 595 | 6.70% | 37.50% | 33.61% | 22.18% | NA |
| Indica II | 465 | 21.70% | 47.10% | 17.42% | 13.76% | NA |
| Indica III | 913 | 9.10% | 66.90% | 8.00% | 15.99% | NA |
| Indica Intermediate | 786 | 18.20% | 42.50% | 20.74% | 18.58% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.60% | 4.80% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 97.90% | 1.20% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 95.80% | 1.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 57.80% | 18.90% | 15.56% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0117840935 | A -> T | LOC_Os01g32520.1 | upstream_gene_variant ; 3469.0bp to feature; MODIFIER | silent_mutation | Average:26.451; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 | N | N | N | N |
| vg0117840935 | A -> T | LOC_Os01g32530.1 | upstream_gene_variant ; 35.0bp to feature; MODIFIER | silent_mutation | Average:26.451; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 | N | N | N | N |
| vg0117840935 | A -> T | LOC_Os01g32520-LOC_Os01g32530 | intergenic_region ; MODIFIER | silent_mutation | Average:26.451; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 | N | N | N | N |
| vg0117840935 | A -> DEL | N | N | silent_mutation | Average:26.451; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0117840935 | NA | 5.03E-07 | mr1518 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117840935 | 7.98E-06 | NA | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117840935 | 2.00E-06 | NA | mr1318_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117840935 | NA | 6.74E-07 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117840935 | NA | 1.36E-06 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117840935 | 4.51E-06 | NA | mr1746_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117840935 | 9.79E-06 | NA | mr1788_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117840935 | 1.72E-07 | 2.60E-08 | mr1871_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |