Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0117840935:

Variant ID: vg0117840935 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 17840935
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

AAGGGCTATACATGTTGGGTGAAGCATGGAGAGTAAGAATCAGGAAGTGGAGCAGCAGCAGACAGAAGTGGTGCACATAATCAGGAAGATGAAGATGAGC[A/T]
TGACATGTTTATACCTTCTCCATTGGGCGGTGAAATGGTTGATGTGGATCACGATCTGCTGCAAGACATGTTACGTGACGTTGAGGACCCAGCCCAGAAT

Reverse complement sequence

ATTCTGGGCTGGGTCCTCAACGTCACGTAACATGTCTTGCAGCAGATCGTGATCCACATCAACCATTTCACCGCCCAATGGAGAAGGTATAAACATGTCA[T/A]
GCTCATCTTCATCTTCCTGATTATGTGCACCACTTCTGTCTGCTGCTGCTCCACTTCCTGATTCTTACTCTCCATGCTTCACCCAACATGTATAGCCCTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.00%	31.50%	11.85%	11.70%	NA
All Indica	2759	13.30%	50.30%	18.74%	17.69%	NA
All Japonica	1512	97.40%	2.20%	0.13%	0.20%	NA
Aus	269	52.80%	17.80%	10.04%	19.33%	NA
Indica I	595	6.70%	37.50%	33.61%	22.18%	NA
Indica II	465	21.70%	47.10%	17.42%	13.76%	NA
Indica III	913	9.10%	66.90%	8.00%	15.99%	NA
Indica Intermediate	786	18.20%	42.50%	20.74%	18.58%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	94.60%	4.80%	0.20%	0.40%	NA
Japonica Intermediate	241	97.90%	1.20%	0.41%	0.41%	NA
VI/Aromatic	96	95.80%	1.00%	0.00%	3.12%	NA
Intermediate	90	57.80%	18.90%	15.56%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0117840935	A -> T	LOC_Os01g32520.1	upstream_gene_variant ; 3469.0bp to feature; MODIFIER	silent_mutation	Average:26.451; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg0117840935	A -> T	LOC_Os01g32530.1	upstream_gene_variant ; 35.0bp to feature; MODIFIER	silent_mutation	Average:26.451; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg0117840935	A -> T	LOC_Os01g32520-LOC_Os01g32530	intergenic_region ; MODIFIER	silent_mutation	Average:26.451; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg0117840935	A -> DEL	N	N	silent_mutation	Average:26.451; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0117840935	NA	5.03E-07	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117840935	7.98E-06	NA	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117840935	2.00E-06	NA	mr1318_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117840935	NA	6.74E-07	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117840935	NA	1.36E-06	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117840935	4.51E-06	NA	mr1746_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117840935	9.79E-06	NA	mr1788_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117840935	1.72E-07	2.60E-08	mr1871_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251