\
| Variant ID: vg0117778414 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 17778414 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, A: 0.44, others allele: 0.00, population size: 99. )
AAAGCTTACCTCACTTCCCCCCCATCTTGGTGGCTCCGGGACCGGAGGAACCATTGCTACTCTACTTGGCCGCGACCCCCCATGTGGTGAGTGCCGCCCT[T/A]
GTAGTTGAGCGTGAGGAAGGCGAACGGGAGGCCCCTTCGGCTTGCGATGGCCCCTCGTCCCCCGAAGGCCTAGCGCCCAAAGCTTCCAGCCCCCGGGAGA
TCTCCCGGGGGCTGGAAGCTTTGGGCGCTAGGCCTTCGGGGGACGAGGGGCCATCGCAAGCCGAAGGGGCCTCCCGTTCGCCTTCCTCACGCTCAACTAC[A/T]
AGGGCGGCACTCACCACATGGGGGGTCGCGGCCAAGTAGAGTAGCAATGGTTCCTCCGGTCCCGGAGCCACCAAGATGGGGGGGAAGTGAGGTAAGCTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.50% | 35.20% | 0.42% | 26.89% | NA |
| All Indica | 2759 | 2.80% | 55.30% | 0.72% | 41.17% | NA |
| All Japonica | 1512 | 97.40% | 2.30% | 0.00% | 0.26% | NA |
| Aus | 269 | 31.60% | 27.50% | 0.00% | 40.89% | NA |
| Indica I | 595 | 1.20% | 38.70% | 0.67% | 59.50% | NA |
| Indica II | 465 | 4.30% | 60.00% | 0.86% | 34.84% | NA |
| Indica III | 913 | 1.00% | 69.70% | 0.11% | 29.24% | NA |
| Indica Intermediate | 786 | 5.20% | 48.50% | 1.40% | 44.91% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.60% | 5.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 97.90% | 1.20% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 92.70% | 2.10% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 54.40% | 27.80% | 0.00% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0117778414 | T -> A | LOC_Os01g32400.1 | downstream_gene_variant ; 1061.0bp to feature; MODIFIER | silent_mutation | Average:59.439; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 | N | N | N | N |
| vg0117778414 | T -> A | LOC_Os01g32410.1 | downstream_gene_variant ; 214.0bp to feature; MODIFIER | silent_mutation | Average:59.439; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 | N | N | N | N |
| vg0117778414 | T -> A | LOC_Os01g32420.1 | downstream_gene_variant ; 4625.0bp to feature; MODIFIER | silent_mutation | Average:59.439; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 | N | N | N | N |
| vg0117778414 | T -> A | LOC_Os01g32400-LOC_Os01g32410 | intergenic_region ; MODIFIER | silent_mutation | Average:59.439; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 | N | N | N | N |
| vg0117778414 | T -> DEL | N | N | silent_mutation | Average:59.439; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0117778414 | 3.08E-06 | NA | mr1253 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117778414 | 1.60E-06 | 1.60E-08 | mr1253 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117778414 | NA | 1.04E-07 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117778414 | NA | 8.18E-08 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117778414 | NA | 6.62E-06 | mr1852_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |