Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0117778414:

Variant ID: vg0117778414 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 17778414
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, A: 0.44, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGCTTACCTCACTTCCCCCCCATCTTGGTGGCTCCGGGACCGGAGGAACCATTGCTACTCTACTTGGCCGCGACCCCCCATGTGGTGAGTGCCGCCCT[T/A]
GTAGTTGAGCGTGAGGAAGGCGAACGGGAGGCCCCTTCGGCTTGCGATGGCCCCTCGTCCCCCGAAGGCCTAGCGCCCAAAGCTTCCAGCCCCCGGGAGA

Reverse complement sequence

TCTCCCGGGGGCTGGAAGCTTTGGGCGCTAGGCCTTCGGGGGACGAGGGGCCATCGCAAGCCGAAGGGGCCTCCCGTTCGCCTTCCTCACGCTCAACTAC[A/T]
AGGGCGGCACTCACCACATGGGGGGTCGCGGCCAAGTAGAGTAGCAATGGTTCCTCCGGTCCCGGAGCCACCAAGATGGGGGGGAAGTGAGGTAAGCTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.50%	35.20%	0.42%	26.89%	NA
All Indica	2759	2.80%	55.30%	0.72%	41.17%	NA
All Japonica	1512	97.40%	2.30%	0.00%	0.26%	NA
Aus	269	31.60%	27.50%	0.00%	40.89%	NA
Indica I	595	1.20%	38.70%	0.67%	59.50%	NA
Indica II	465	4.30%	60.00%	0.86%	34.84%	NA
Indica III	913	1.00%	69.70%	0.11%	29.24%	NA
Indica Intermediate	786	5.20%	48.50%	1.40%	44.91%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	94.60%	5.00%	0.00%	0.40%	NA
Japonica Intermediate	241	97.90%	1.20%	0.00%	0.83%	NA
VI/Aromatic	96	92.70%	2.10%	0.00%	5.21%	NA
Intermediate	90	54.40%	27.80%	0.00%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0117778414	T -> A	LOC_Os01g32400.1	downstream_gene_variant ; 1061.0bp to feature; MODIFIER	silent_mutation	Average:59.439; most accessible tissue: Zhenshan97 flag leaf, score: 74.498	N	N	N	N
vg0117778414	T -> A	LOC_Os01g32410.1	downstream_gene_variant ; 214.0bp to feature; MODIFIER	silent_mutation	Average:59.439; most accessible tissue: Zhenshan97 flag leaf, score: 74.498	N	N	N	N
vg0117778414	T -> A	LOC_Os01g32420.1	downstream_gene_variant ; 4625.0bp to feature; MODIFIER	silent_mutation	Average:59.439; most accessible tissue: Zhenshan97 flag leaf, score: 74.498	N	N	N	N
vg0117778414	T -> A	LOC_Os01g32400-LOC_Os01g32410	intergenic_region ; MODIFIER	silent_mutation	Average:59.439; most accessible tissue: Zhenshan97 flag leaf, score: 74.498	N	N	N	N
vg0117778414	T -> DEL	N	N	silent_mutation	Average:59.439; most accessible tissue: Zhenshan97 flag leaf, score: 74.498	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0117778414	3.08E-06	NA	mr1253	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117778414	1.60E-06	1.60E-08	mr1253	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117778414	NA	1.04E-07	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117778414	NA	8.18E-08	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117778414	NA	6.62E-06	mr1852_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251