\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0117778414:

Variant ID: vg0117778414 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 17778414
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, A: 0.44, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGCTTACCTCACTTCCCCCCCATCTTGGTGGCTCCGGGACCGGAGGAACCATTGCTACTCTACTTGGCCGCGACCCCCCATGTGGTGAGTGCCGCCCT[T/A]
GTAGTTGAGCGTGAGGAAGGCGAACGGGAGGCCCCTTCGGCTTGCGATGGCCCCTCGTCCCCCGAAGGCCTAGCGCCCAAAGCTTCCAGCCCCCGGGAGA

Reverse complement sequence

TCTCCCGGGGGCTGGAAGCTTTGGGCGCTAGGCCTTCGGGGGACGAGGGGCCATCGCAAGCCGAAGGGGCCTCCCGTTCGCCTTCCTCACGCTCAACTAC[A/T]
AGGGCGGCACTCACCACATGGGGGGTCGCGGCCAAGTAGAGTAGCAATGGTTCCTCCGGTCCCGGAGCCACCAAGATGGGGGGGAAGTGAGGTAAGCTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.50% 35.20% 0.42% 26.89% NA
All Indica  2759 2.80% 55.30% 0.72% 41.17% NA
All Japonica  1512 97.40% 2.30% 0.00% 0.26% NA
Aus  269 31.60% 27.50% 0.00% 40.89% NA
Indica I  595 1.20% 38.70% 0.67% 59.50% NA
Indica II  465 4.30% 60.00% 0.86% 34.84% NA
Indica III  913 1.00% 69.70% 0.11% 29.24% NA
Indica Intermediate  786 5.20% 48.50% 1.40% 44.91% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 94.60% 5.00% 0.00% 0.40% NA
Japonica Intermediate  241 97.90% 1.20% 0.00% 0.83% NA
VI/Aromatic  96 92.70% 2.10% 0.00% 5.21% NA
Intermediate  90 54.40% 27.80% 0.00% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0117778414 T -> A LOC_Os01g32400.1 downstream_gene_variant ; 1061.0bp to feature; MODIFIER silent_mutation Average:59.439; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 N N N N
vg0117778414 T -> A LOC_Os01g32410.1 downstream_gene_variant ; 214.0bp to feature; MODIFIER silent_mutation Average:59.439; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 N N N N
vg0117778414 T -> A LOC_Os01g32420.1 downstream_gene_variant ; 4625.0bp to feature; MODIFIER silent_mutation Average:59.439; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 N N N N
vg0117778414 T -> A LOC_Os01g32400-LOC_Os01g32410 intergenic_region ; MODIFIER silent_mutation Average:59.439; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 N N N N
vg0117778414 T -> DEL N N silent_mutation Average:59.439; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0117778414 3.08E-06 NA mr1253 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117778414 1.60E-06 1.60E-08 mr1253 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117778414 NA 1.04E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117778414 NA 8.18E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117778414 NA 6.62E-06 mr1852_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251