\
| Variant ID: vg0117665352 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 17665352 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 254. )
TGAATTTTCATTGGTACACAGAGAATTTACTCATAGCAAAGCGCTAGTGACTGACCTGTCTCTCCCCCATGTCAGGCAATGGAAAGCAAGGAGCGATGTT[G/A]
TATGAAATGGATTGCTTCAATGCATAGGTTTTTTTTGAAACAAACCCGAAAACATAAGCTAGATATTGTGATATTTACTTTATATTATCCTCTGGAGTAT
ATACTCCAGAGGATAATATAAAGTAAATATCACAATATCTAGCTTATGTTTTCGGGTTTGTTTCAAAAAAAACCTATGCATTGAAGCAATCCATTTCATA[C/T]
AACATCGCTCCTTGCTTTCCATTGCCTGACATGGGGGAGAGACAGGTCAGTCACTAGCGCTTTGCTATGAGTAAATTCTCTGTGTACCAATGAAAATTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.00% | 18.80% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 70.90% | 28.90% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 80.70% | 19.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 62.40% | 37.30% | 0.34% | 0.00% | NA |
| Indica II | 465 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 60.40% | 39.40% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 75.20% | 24.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0117665352 | G -> A | LOC_Os01g32250.1 | upstream_gene_variant ; 1835.0bp to feature; MODIFIER | silent_mutation | Average:56.622; most accessible tissue: Minghui63 root, score: 71.259 | N | N | N | N |
| vg0117665352 | G -> A | LOC_Os01g32230-LOC_Os01g32250 | intergenic_region ; MODIFIER | silent_mutation | Average:56.622; most accessible tissue: Minghui63 root, score: 71.259 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0117665352 | 4.75E-07 | NA | mr1519 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117665352 | 8.03E-07 | 9.75E-09 | mr1519 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117665352 | NA | 4.16E-06 | mr1105_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117665352 | NA | 9.29E-08 | mr1218_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117665352 | NA | 2.96E-07 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117665352 | 4.23E-12 | NA | mr1519_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117665352 | 4.70E-12 | 1.99E-20 | mr1519_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117665352 | NA | 4.04E-06 | mr1874_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117665352 | NA | 2.42E-06 | mr1901_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |