Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0117632054:

Variant ID: vg0117632054 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 17632054
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.26, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

CATCTCAGTGCGTCGTCCGCGTGAGCGCATCAATCGATGATCTCGAACAATCTTTGATTAGTTGTGATCCGCCTTGTTCCCAACTCCTAGGTAGTATAGC[A/G]
ATCTCTAACACCGGTTTTGAAAACGCGAATCACAGATGCGTCGATGATTTCGGGGATTGTATTTCTGCACTCATTAAAGCGCCGAACATAGTCCCTCAAA

Reverse complement sequence

TTTGAGGGACTATGTTCGGCGCTTTAATGAGTGCAGAAATACAATCCCCGAAATCATCGACGCATCTGTGATTCGCGTTTTCAAAACCGGTGTTAGAGAT[T/C]
GCTATACTACCTAGGAGTTGGGAACAAGGCGGATCACAACTAATCAAAGATTGTTCGAGATCATCGATTGATGCGCTCACGCGGACGACGCACTGAGATG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.10%	24.60%	0.30%	0.00%	NA
All Indica	2759	95.00%	5.00%	0.04%	0.00%	NA
All Japonica	1512	46.00%	53.30%	0.66%	0.00%	NA
Aus	269	61.70%	37.50%	0.74%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	86.50%	13.50%	0.00%	0.00%	NA
Indica III	913	98.60%	1.40%	0.00%	0.00%	NA
Indica Intermediate	786	92.50%	7.40%	0.13%	0.00%	NA
Temperate Japonica	767	75.50%	23.60%	0.91%	0.00%	NA
Tropical Japonica	504	6.90%	92.90%	0.20%	0.00%	NA
Japonica Intermediate	241	34.00%	65.10%	0.83%	0.00%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	66.70%	32.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0117632054	A -> G	LOC_Os01g32210.1	missense_variant ; p.Cys438Arg; MODERATE	nonsynonymous_codon ; C438R	Average:50.015; most accessible tissue: Minghui63 flag leaf, score: 61.847	unknown	unknown	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0117632054	NA	1.23E-10	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0117632054	NA	2.68E-12	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0117632054	NA	2.49E-11	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0117632054	NA	3.36E-07	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117632054	NA	4.27E-07	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117632054	NA	2.73E-08	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117632054	NA	6.23E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117632054	NA	1.16E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117632054	NA	1.18E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117632054	NA	1.53E-09	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117632054	NA	1.39E-07	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117632054	NA	1.46E-06	mr1138_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117632054	3.74E-06	3.74E-06	mr1181_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117632054	NA	7.76E-06	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117632054	NA	3.80E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117632054	NA	5.34E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251