Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0117579885:

Variant ID: vg0117579885 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 17579885
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCAACAGTCATACAATAATGACATATCTTTATTCATACAAAAATTATAAAATATTACACCAAATAATTATTATTTACTATTTCTAAAGTTTTAAACTAAT[T/A]
TTAATGTGTTTTACTTCTTTTAATTTTCATTTTAGTTTGTTTTCTATTATTTAAGATTAACTTTCACTATATTTTCCTTCTCAACTATTTTATAAAACCT

Reverse complement sequence

AGGTTTTATAAAATAGTTGAGAAGGAAAATATAGTGAAAGTTAATCTTAAATAATAGAAAACAAACTAAAATGAAAATTAAAAGAAGTAAAACACATTAA[A/T]
ATTAGTTTAAAACTTTAGAAATAGTAAATAATAATTATTTGGTGTAATATTTTATAATTTTTGTATGAATAAAGATATGTCATTATTGTATGACTGTTGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.40%	1.10%	51.52%	6.92%	NA
All Indica	2759	6.60%	1.80%	80.54%	11.13%	NA
All Japonica	1512	97.40%	0.00%	2.18%	0.46%	NA
Aus	269	41.60%	1.50%	55.02%	1.86%	NA
Indica I	595	2.50%	3.70%	77.65%	16.13%	NA
Indica II	465	6.20%	0.60%	74.19%	18.92%	NA
Indica III	913	7.60%	1.40%	85.87%	5.15%	NA
Indica Intermediate	786	8.70%	1.40%	80.28%	9.67%	NA
Temperate Japonica	767	99.00%	0.00%	0.78%	0.26%	NA
Tropical Japonica	504	94.60%	0.00%	4.56%	0.79%	NA
Japonica Intermediate	241	97.90%	0.00%	1.66%	0.41%	NA
VI/Aromatic	96	93.80%	1.00%	5.21%	0.00%	NA
Intermediate	90	61.10%	0.00%	30.00%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0117579885	T -> A	LOC_Os01g32110.1	upstream_gene_variant ; 427.0bp to feature; MODIFIER	silent_mutation	Average:7.569; most accessible tissue: Minghui63 flower, score: 12.456	N	N	N	N
vg0117579885	T -> A	LOC_Os01g32120.1	upstream_gene_variant ; 1228.0bp to feature; MODIFIER	silent_mutation	Average:7.569; most accessible tissue: Minghui63 flower, score: 12.456	N	N	N	N
vg0117579885	T -> A	LOC_Os01g32130.1	upstream_gene_variant ; 3760.0bp to feature; MODIFIER	silent_mutation	Average:7.569; most accessible tissue: Minghui63 flower, score: 12.456	N	N	N	N
vg0117579885	T -> A	LOC_Os01g32110-LOC_Os01g32120	intergenic_region ; MODIFIER	silent_mutation	Average:7.569; most accessible tissue: Minghui63 flower, score: 12.456	N	N	N	N
vg0117579885	T -> DEL	N	N	silent_mutation	Average:7.569; most accessible tissue: Minghui63 flower, score: 12.456	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0117579885	9.74E-07	9.74E-07	mr1388	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251