Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0117519898:

Variant ID: vg0117519898 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 17519898
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

GGGGAAATGTGTGACTTGCCTTGCTTCTTCAAACAATCTTCCAAACTCTTATCCTTGCGACCGCGATCTTCCGAAACGACGGATTCTACACGCTAGCACG[C/T]
AAAATGAGGAAAAACTCTAATAAAAACCAAAAAAACAGTACATGAAAAGTAAACAAACATGTAGAGCTCAATTTTAGATGAATTTTGCAAGTTGAATGGC

Reverse complement sequence

GCCATTCAACTTGCAAAATTCATCTAAAATTGAGCTCTACATGTTTGTTTACTTTTCATGTACTGTTTTTTTGGTTTTTATTAGAGTTTTTCCTCATTTT[G/A]
CGTGCTAGCGTGTAGAATCCGTCGTTTCGGAAGATCGCGGTCGCAAGGATAAGAGTTTGGAAGATTGTTTGAAGAAGCAAGGCAAGTCACACATTTCCCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.10%	18.40%	0.47%	0.04%	NA
All Indica	2759	71.00%	28.20%	0.80%	0.07%	NA
All Japonica	1512	97.80%	2.20%	0.00%	0.00%	NA
Aus	269	79.90%	20.10%	0.00%	0.00%	NA
Indica I	595	62.50%	37.10%	0.34%	0.00%	NA
Indica II	465	95.50%	4.30%	0.22%	0.00%	NA
Indica III	913	60.00%	37.80%	1.97%	0.22%	NA
Indica Intermediate	786	75.60%	24.30%	0.13%	0.00%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	95.20%	4.80%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0117519898	C -> T	LOC_Os01g32000.1	upstream_gene_variant ; 680.0bp to feature; MODIFIER	silent_mutation	Average:31.891; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N
vg0117519898	C -> T	LOC_Os01g31990.1	downstream_gene_variant ; 2085.0bp to feature; MODIFIER	silent_mutation	Average:31.891; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N
vg0117519898	C -> T	LOC_Os01g32010.1	downstream_gene_variant ; 4165.0bp to feature; MODIFIER	silent_mutation	Average:31.891; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N
vg0117519898	C -> T	LOC_Os01g31990-LOC_Os01g32000	intergenic_region ; MODIFIER	silent_mutation	Average:31.891; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N
vg0117519898	C -> DEL	N	N	silent_mutation	Average:31.891; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0117519898	NA	3.47E-07	mr1105_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898	NA	1.14E-07	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898	NA	1.33E-06	mr1421_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898	1.89E-07	NA	mr1519_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898	1.07E-06	3.99E-16	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898	NA	3.62E-06	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898	NA	1.91E-08	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898	NA	6.55E-06	mr1562_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898	9.35E-06	9.32E-06	mr1643_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898	NA	1.86E-06	mr1661_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898	NA	7.21E-06	mr1696_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898	NA	4.08E-07	mr1721_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898	NA	1.11E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898	NA	3.00E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898	NA	2.10E-06	mr1862_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898	5.04E-07	NA	mr1873_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898	2.30E-06	1.29E-06	mr1873_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898	NA	2.49E-06	mr1874_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898	NA	2.21E-06	mr1901_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898	7.40E-06	7.38E-06	mr1953_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251