\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0117519898:

Variant ID: vg0117519898 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 17519898
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


GGGGAAATGTGTGACTTGCCTTGCTTCTTCAAACAATCTTCCAAACTCTTATCCTTGCGACCGCGATCTTCCGAAACGACGGATTCTACACGCTAGCACG[C/T]
AAAATGAGGAAAAACTCTAATAAAAACCAAAAAAACAGTACATGAAAAGTAAACAAACATGTAGAGCTCAATTTTAGATGAATTTTGCAAGTTGAATGGC

Reverse complement sequence

GCCATTCAACTTGCAAAATTCATCTAAAATTGAGCTCTACATGTTTGTTTACTTTTCATGTACTGTTTTTTTGGTTTTTATTAGAGTTTTTCCTCATTTT[G/A]
CGTGCTAGCGTGTAGAATCCGTCGTTTCGGAAGATCGCGGTCGCAAGGATAAGAGTTTGGAAGATTGTTTGAAGAAGCAAGGCAAGTCACACATTTCCCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.10% 18.40% 0.47% 0.04% NA
All Indica  2759 71.00% 28.20% 0.80% 0.07% NA
All Japonica  1512 97.80% 2.20% 0.00% 0.00% NA
Aus  269 79.90% 20.10% 0.00% 0.00% NA
Indica I  595 62.50% 37.10% 0.34% 0.00% NA
Indica II  465 95.50% 4.30% 0.22% 0.00% NA
Indica III  913 60.00% 37.80% 1.97% 0.22% NA
Indica Intermediate  786 75.60% 24.30% 0.13% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 95.20% 4.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0117519898 C -> T LOC_Os01g32000.1 upstream_gene_variant ; 680.0bp to feature; MODIFIER silent_mutation Average:31.891; most accessible tissue: Minghui63 young leaf, score: 54.11 N N N N
vg0117519898 C -> T LOC_Os01g31990.1 downstream_gene_variant ; 2085.0bp to feature; MODIFIER silent_mutation Average:31.891; most accessible tissue: Minghui63 young leaf, score: 54.11 N N N N
vg0117519898 C -> T LOC_Os01g32010.1 downstream_gene_variant ; 4165.0bp to feature; MODIFIER silent_mutation Average:31.891; most accessible tissue: Minghui63 young leaf, score: 54.11 N N N N
vg0117519898 C -> T LOC_Os01g31990-LOC_Os01g32000 intergenic_region ; MODIFIER silent_mutation Average:31.891; most accessible tissue: Minghui63 young leaf, score: 54.11 N N N N
vg0117519898 C -> DEL N N silent_mutation Average:31.891; most accessible tissue: Minghui63 young leaf, score: 54.11 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0117519898 NA 3.47E-07 mr1105_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898 NA 1.14E-07 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898 NA 1.33E-06 mr1421_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898 1.89E-07 NA mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898 1.07E-06 3.99E-16 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898 NA 3.62E-06 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898 NA 1.91E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898 NA 6.55E-06 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898 9.35E-06 9.32E-06 mr1643_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898 NA 1.86E-06 mr1661_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898 NA 7.21E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898 NA 4.08E-07 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898 NA 1.11E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898 NA 3.00E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898 NA 2.10E-06 mr1862_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898 5.04E-07 NA mr1873_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898 2.30E-06 1.29E-06 mr1873_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898 NA 2.49E-06 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898 NA 2.21E-06 mr1901_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117519898 7.40E-06 7.38E-06 mr1953_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251