\
| Variant ID: vg0117060548 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 17060548 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 81. )
CTGATAATTAAGTTCACGAGCTCGAGCTCTAGTCATTGGTCCTTGCTGTGTAATAGGCGTGGTTGTATCGTTGGAAGGGATGTCCTCATCATCCACCATG[T/C]
GCGCCAGGTGCATGATGGTAGCGTCATCCTCCGAGCTAGCATCCCGGAAGGTGGCGTAGTCGCGGGCTCCTCCGCGACGAGGGTGGTAGCGGTAGGGCAA
TTGCCCTACCGCTACCACCCTCGTCGCGGAGGAGCCCGCGACTACGCCACCTTCCGGGATGCTAGCTCGGAGGATGACGCTACCATCATGCACCTGGCGC[A/G]
CATGGTGGATGATGAGGACATCCCTTCCAACGATACAACCACGCCTATTACACAGCAAGGACCAATGACTAGAGCTCGAGCTCGTGAACTTAATTATCAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 25.50% | 12.20% | 30.91% | 31.40% | NA |
| All Indica | 2759 | 3.00% | 3.10% | 44.04% | 49.91% | NA |
| All Japonica | 1512 | 60.10% | 31.80% | 5.89% | 2.25% | NA |
| Aus | 269 | 32.00% | 0.40% | 47.58% | 20.07% | NA |
| Indica I | 595 | 1.50% | 1.80% | 35.46% | 61.18% | NA |
| Indica II | 465 | 4.90% | 1.50% | 47.53% | 46.02% | NA |
| Indica III | 913 | 1.10% | 3.60% | 48.63% | 46.66% | NA |
| Indica Intermediate | 786 | 5.10% | 4.30% | 43.13% | 47.46% | NA |
| Temperate Japonica | 767 | 39.10% | 51.50% | 8.47% | 0.91% | NA |
| Tropical Japonica | 504 | 91.70% | 1.60% | 2.18% | 4.56% | NA |
| Japonica Intermediate | 241 | 60.60% | 32.40% | 5.39% | 1.66% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 5.21% | 1.04% | NA |
| Intermediate | 90 | 44.40% | 8.90% | 26.67% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0117060548 | T -> DEL | LOC_Os01g31200.1 | N | frameshift_variant | Average:16.8; most accessible tissue: Callus, score: 37.276 | N | N | N | N |
| vg0117060548 | T -> C | LOC_Os01g31200.1 | missense_variant ; p.His189Arg; MODERATE | nonsynonymous_codon ; H189R | Average:16.8; most accessible tissue: Callus, score: 37.276 | unknown | unknown | TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0117060548 | NA | 3.08E-06 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117060548 | NA | 1.07E-10 | mr1084 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117060548 | NA | 5.37E-18 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117060548 | NA | 1.89E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117060548 | 7.42E-06 | 8.29E-07 | mr1170 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117060548 | NA | 4.85E-07 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117060548 | NA | 2.78E-12 | mr1205 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117060548 | 4.96E-06 | NA | mr1318 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117060548 | NA | 4.94E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117060548 | NA | 7.37E-07 | mr1359 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117060548 | NA | 5.39E-07 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117060548 | NA | 1.93E-06 | mr1576 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117060548 | NA | 7.25E-20 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117060548 | NA | 4.42E-08 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117060548 | NA | 1.86E-07 | mr1680 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117060548 | NA | 3.75E-06 | mr1729 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117060548 | NA | 5.55E-08 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117060548 | NA | 4.46E-19 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117060548 | NA | 4.30E-07 | mr1851 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |