\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0117039557:

Variant ID: vg0117039557 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 17039557
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATATTTAATTGTATCTCACGATGGTTAATAGTGATTGGTTAATTAATTAATTTGCCAACTAAAACTTGATAATGGTGGGATGTGAGCACATGGTTTTGAT[A/G]
GTAGTGCTCATGACAATTAAGGACCGGTTCACGAGTTTCGGTTGTAAAACATTAGCCGTGCCAACCACAAGCCAGAATGCGCAACGGTTGGACACTTTGT

Reverse complement sequence

ACAAAGTGTCCAACCGTTGCGCATTCTGGCTTGTGGTTGGCACGGCTAATGTTTTACAACCGAAACTCGTGAACCGGTCCTTAATTGTCATGAGCACTAC[T/C]
ATCAAAACCATGTGCTCACATCCCACCATTATCAAGTTTTAGTTGGCAAATTAATTAATTAACCAATCACTATTAACCATCGTGAGATACAATTAAATAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.50% 2.90% 2.92% 55.63% NA
All Indica  2759 5.20% 3.30% 3.08% 88.47% NA
All Japonica  1512 96.00% 1.50% 0.00% 2.51% NA
Aus  269 32.00% 7.10% 18.96% 42.01% NA
Indica I  595 4.40% 0.00% 1.68% 93.95% NA
Indica II  465 5.60% 11.00% 1.72% 81.72% NA
Indica III  913 2.80% 1.00% 4.60% 91.57% NA
Indica Intermediate  786 8.30% 3.80% 3.18% 84.73% NA
Temperate Japonica  767 98.80% 0.30% 0.00% 0.91% NA
Tropical Japonica  504 94.60% 0.20% 0.00% 5.16% NA
Japonica Intermediate  241 89.60% 8.30% 0.00% 2.07% NA
VI/Aromatic  96 93.80% 0.00% 1.04% 5.21% NA
Intermediate  90 56.70% 6.70% 1.11% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0117039557 A -> G LOC_Os01g31170.1 upstream_gene_variant ; 4310.0bp to feature; MODIFIER silent_mutation Average:12.704; most accessible tissue: Callus, score: 31.671 N N N N
vg0117039557 A -> G LOC_Os01g31150.1 downstream_gene_variant ; 2321.0bp to feature; MODIFIER silent_mutation Average:12.704; most accessible tissue: Callus, score: 31.671 N N N N
vg0117039557 A -> G LOC_Os01g31160.1 intron_variant ; MODIFIER silent_mutation Average:12.704; most accessible tissue: Callus, score: 31.671 N N N N
vg0117039557 A -> DEL N N silent_mutation Average:12.704; most accessible tissue: Callus, score: 31.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0117039557 NA 1.45E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117039557 NA 2.65E-17 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117039557 NA 7.07E-46 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117039557 NA 8.66E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117039557 NA 2.95E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117039557 2.53E-06 NA mr1707_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117039557 NA 8.01E-24 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117039557 NA 1.03E-13 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117039557 NA 7.78E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117039557 9.18E-06 NA mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251