\
| Variant ID: vg0117039557 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 17039557 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATATTTAATTGTATCTCACGATGGTTAATAGTGATTGGTTAATTAATTAATTTGCCAACTAAAACTTGATAATGGTGGGATGTGAGCACATGGTTTTGAT[A/G]
GTAGTGCTCATGACAATTAAGGACCGGTTCACGAGTTTCGGTTGTAAAACATTAGCCGTGCCAACCACAAGCCAGAATGCGCAACGGTTGGACACTTTGT
ACAAAGTGTCCAACCGTTGCGCATTCTGGCTTGTGGTTGGCACGGCTAATGTTTTACAACCGAAACTCGTGAACCGGTCCTTAATTGTCATGAGCACTAC[T/C]
ATCAAAACCATGTGCTCACATCCCACCATTATCAAGTTTTAGTTGGCAAATTAATTAATTAACCAATCACTATTAACCATCGTGAGATACAATTAAATAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.50% | 2.90% | 2.92% | 55.63% | NA |
| All Indica | 2759 | 5.20% | 3.30% | 3.08% | 88.47% | NA |
| All Japonica | 1512 | 96.00% | 1.50% | 0.00% | 2.51% | NA |
| Aus | 269 | 32.00% | 7.10% | 18.96% | 42.01% | NA |
| Indica I | 595 | 4.40% | 0.00% | 1.68% | 93.95% | NA |
| Indica II | 465 | 5.60% | 11.00% | 1.72% | 81.72% | NA |
| Indica III | 913 | 2.80% | 1.00% | 4.60% | 91.57% | NA |
| Indica Intermediate | 786 | 8.30% | 3.80% | 3.18% | 84.73% | NA |
| Temperate Japonica | 767 | 98.80% | 0.30% | 0.00% | 0.91% | NA |
| Tropical Japonica | 504 | 94.60% | 0.20% | 0.00% | 5.16% | NA |
| Japonica Intermediate | 241 | 89.60% | 8.30% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 1.04% | 5.21% | NA |
| Intermediate | 90 | 56.70% | 6.70% | 1.11% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0117039557 | A -> G | LOC_Os01g31170.1 | upstream_gene_variant ; 4310.0bp to feature; MODIFIER | silent_mutation | Average:12.704; most accessible tissue: Callus, score: 31.671 | N | N | N | N |
| vg0117039557 | A -> G | LOC_Os01g31150.1 | downstream_gene_variant ; 2321.0bp to feature; MODIFIER | silent_mutation | Average:12.704; most accessible tissue: Callus, score: 31.671 | N | N | N | N |
| vg0117039557 | A -> G | LOC_Os01g31160.1 | intron_variant ; MODIFIER | silent_mutation | Average:12.704; most accessible tissue: Callus, score: 31.671 | N | N | N | N |
| vg0117039557 | A -> DEL | N | N | silent_mutation | Average:12.704; most accessible tissue: Callus, score: 31.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0117039557 | NA | 1.45E-06 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117039557 | NA | 2.65E-17 | mr1281_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117039557 | NA | 7.07E-46 | mr1519_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117039557 | NA | 8.66E-07 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117039557 | NA | 2.95E-12 | mr1666_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117039557 | 2.53E-06 | NA | mr1707_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117039557 | NA | 8.01E-24 | mr1708_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117039557 | NA | 1.03E-13 | mr1770_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117039557 | NA | 7.78E-08 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0117039557 | 9.18E-06 | NA | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |