Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0116970135:

Variant ID: vg0116970135 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 16970135
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGACCGGGAAATTCTTCCCGGGTGCACACGAGTGAGGACAAAGTGTGCAGAAAATATATGTATTGGTCTGTGAGGACAGTCTATTACCTATGAAAGCTAT[C/T]
AGATGTAAGCGGGCCCGGCCTAGGGGAAGGCGGGACGTTACAAAATGGTATCAGAGCCGACTCTCGCGGTTTCACGGGCGCGTGTGTCGCAGTTGCGCAG

Reverse complement sequence

CTGCGCAACTGCGACACACGCGCCCGTGAAACCGCGAGAGTCGGCTCTGATACCATTTTGTAACGTCCCGCCTTCCCCTAGGCCGGGCCCGCTTACATCT[G/A]
ATAGCTTTCATAGGTAATAGACTGTCCTCACAGACCAATACATATATTTTCTGCACACTTTGTCCTCACTCGTGTGCACCCGGGAAGAATTTCCCGGTCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.00%	6.00%	20.95%	25.12%	NA
All Indica	2759	28.10%	0.50%	33.02%	38.38%	NA
All Japonica	1512	79.00%	17.10%	2.38%	1.59%	NA
Aus	269	57.60%	0.00%	11.90%	30.48%	NA
Indica I	595	23.00%	0.20%	27.56%	49.24%	NA
Indica II	465	21.90%	1.30%	42.80%	33.98%	NA
Indica III	913	29.60%	0.00%	33.84%	36.58%	NA
Indica Intermediate	786	33.80%	0.90%	30.41%	34.86%	NA
Temperate Japonica	767	94.90%	3.80%	0.65%	0.65%	NA
Tropical Japonica	504	52.40%	39.70%	4.96%	2.98%	NA
Japonica Intermediate	241	83.80%	12.00%	2.49%	1.66%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	55.60%	11.10%	12.22%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0116970135	C -> T	LOC_Os01g31030.1	upstream_gene_variant ; 4645.0bp to feature; MODIFIER	silent_mutation	Average:17.713; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0116970135	C -> T	LOC_Os01g31020.1	intron_variant ; MODIFIER	silent_mutation	Average:17.713; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0116970135	C -> DEL	N	N	silent_mutation	Average:17.713; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0116970135	NA	9.09E-14	Grain_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0116970135	NA	9.57E-07	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116970135	NA	1.68E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116970135	NA	1.79E-08	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116970135	NA	8.83E-08	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116970135	NA	1.19E-06	mr1405	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116970135	NA	2.07E-10	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116970135	NA	2.27E-06	mr1603	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116970135	NA	2.19E-07	mr1603	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116970135	NA	1.86E-06	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116970135	7.58E-06	NA	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116970135	NA	1.31E-07	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116970135	1.82E-06	NA	mr1904	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116970135	NA	5.26E-06	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116970135	NA	2.52E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116970135	NA	6.21E-06	mr1583_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116970135	NA	1.05E-06	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116970135	NA	2.08E-09	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116970135	NA	2.92E-09	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116970135	NA	1.57E-06	mr1705_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251