Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0116924780:

Variant ID: vg0116924780 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 16924780
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGACACTCAAAGCTGTTGTTGGCCCGATCTTTCGATGAGTTGAGATAACTACGATTTGGAAGAAACGTTGACGACCCGACTACAACCGTACAAGACGTT[G/A]
TGTTGCGCCTTAGCGATCGATACACCTCTCCGTAGGTTGTTGATCTTGCCGGTGCAAAGCAACCCTATTCCTGCAAGCAAATCGAAGAAACAAGCAAGAA

Reverse complement sequence

TTCTTGCTTGTTTCTTCGATTTGCTTGCAGGAATAGGGTTGCTTTGCACCGGCAAGATCAACAACCTACGGAGAGGTGTATCGATCGCTAAGGCGCAACA[C/T]
AACGTCTTGTACGGTTGTAGTCGGGTCGTCAACGTTTCTTCCAAATCGTAGTTATCTCAACTCATCGAAAGATCGGGCCAACAACAGCTTTGAGTGTCAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.50%	0.20%	2.01%	34.28%	NA
All Indica	2759	40.00%	0.40%	3.04%	56.61%	NA
All Japonica	1512	98.00%	0.10%	0.53%	1.39%	NA
Aus	269	90.30%	0.00%	0.74%	8.92%	NA
Indica I	595	55.60%	0.00%	1.85%	42.52%	NA
Indica II	465	40.90%	0.40%	3.66%	55.05%	NA
Indica III	913	22.90%	0.70%	4.16%	72.29%	NA
Indica Intermediate	786	47.50%	0.30%	2.29%	50.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	96.40%	0.20%	0.40%	2.98%	NA
Japonica Intermediate	241	95.40%	0.00%	2.49%	2.07%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	85.60%	0.00%	0.00%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0116924780	G -> A	LOC_Os01g30970.1	upstream_gene_variant ; 3838.0bp to feature; MODIFIER	silent_mutation	Average:15.579; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0116924780	G -> A	LOC_Os01g30956-LOC_Os01g30970	intergenic_region ; MODIFIER	silent_mutation	Average:15.579; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0116924780	G -> DEL	N	N	silent_mutation	Average:15.579; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0116924780	NA	7.22E-07	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116924780	NA	6.20E-06	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116924780	NA	2.31E-14	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116924780	NA	7.80E-06	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116924780	4.03E-06	9.22E-20	mr1495	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116924780	NA	6.54E-06	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116924780	NA	3.56E-10	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116924780	NA	1.36E-08	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116924780	NA	7.43E-07	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116924780	NA	9.91E-09	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116924780	NA	2.49E-09	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116924780	NA	2.82E-07	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116924780	NA	1.03E-12	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116924780	NA	5.17E-07	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116924780	NA	1.09E-07	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116924780	NA	2.69E-07	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116924780	NA	2.29E-15	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116924780	NA	6.63E-15	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116924780	NA	2.65E-12	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116924780	NA	5.23E-06	mr1795_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116924780	NA	1.57E-06	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251