| Variant ID: vg0116741094 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 16741094 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 126. )
TAAGCCAACCAGAGGGGGGGGTGAATGGTTGATATACCCAAAAACCAAAACTTTTAGCGGAAATAAAAGTTACCCTCAAATTCGATGGATCGCGGTCTGA[C/T]
TGAAGGTGTTGCGCTGGTCGAACCGCCTGATGAATGTCGGTCTGACCGAGATCGAACTCCGGTCGAACCGCCGAGATGCCTGCTGCCGACTCCTATCGCC
GGCGATAGGAGTCGGCAGCAGGCATCTCGGCGGTTCGACCGGAGTTCGATCTCGGTCAGACCGACATTCATCAGGCGGTTCGACCAGCGCAACACCTTCA[G/A]
TCAGACCGCGATCCATCGAATTTGAGGGTAACTTTTATTTCCGCTAAAAGTTTTGGTTTTTGGGTATATCAACCATTCACCCCCCCCTCTGGTTGGCTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.80% | 2.70% | 2.50% | 0.00% | NA |
| All Indica | 2759 | 91.20% | 4.50% | 4.28% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 76.80% | 10.60% | 12.61% | 0.00% | NA |
| Indica II | 465 | 95.10% | 2.60% | 2.37% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.80% | 6.10% | 4.07% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0116741094 | C -> T | LOC_Os01g29880.1 | upstream_gene_variant ; 180.0bp to feature; MODIFIER | silent_mutation | Average:41.213; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0116741094 | C -> T | LOC_Os01g29890.1 | downstream_gene_variant ; 2087.0bp to feature; MODIFIER | silent_mutation | Average:41.213; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0116741094 | C -> T | LOC_Os01g29880-LOC_Os01g29890 | intergenic_region ; MODIFIER | silent_mutation | Average:41.213; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0116741094 | NA | 7.17E-06 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116741094 | NA | 5.96E-06 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116741094 | NA | 6.08E-08 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116741094 | NA | 3.32E-07 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116741094 | 5.57E-06 | 8.58E-06 | mr1725 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116741094 | NA | 1.91E-06 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116741094 | NA | 1.30E-06 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116741094 | NA | 4.15E-06 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116741094 | NA | 5.98E-06 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |