\
| Variant ID: vg0116676710 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 16676710 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGCCAAGCTGTAGAGCGTGATTTCCTGCGTGCTGCGCCAGATGGCCATCCGCATGGATTTGAAGTCCCATAGGATGGGGCCTAGGGTGCTCAGTCAGGCC[G/A]
TGCCCAAGATGATGTCCACGGAACAGATGTCTAGGGCATAGCAGTCGATTGTGAACGGCTCGCCGTCGATCATGATGTCCAGGTCGTGGCAGAGGCCCGG
CCGGGCCTCTGCCACGACCTGGACATCATGATCGACGGCGAGCCGTTCACAATCGACTGCTATGCCCTAGACATCTGTTCCGTGGACATCATCTTGGGCA[C/T]
GGCCTGACTGAGCACCCTAGGCCCCATCCTATGGGACTTCAAATCCATGCGGATGGCCATCTGGCGCAGCACGCAGGAAATCACGCTCTACAGCTTGGCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.10% | 0.40% | 1.63% | 56.94% | NA |
| All Indica | 2759 | 8.60% | 0.00% | 2.54% | 88.84% | NA |
| All Japonica | 1512 | 96.20% | 1.10% | 0.33% | 2.45% | NA |
| Aus | 269 | 38.70% | 0.00% | 0.74% | 60.59% | NA |
| Indica I | 595 | 2.70% | 0.00% | 2.52% | 94.79% | NA |
| Indica II | 465 | 18.90% | 0.00% | 1.72% | 79.35% | NA |
| Indica III | 913 | 4.20% | 0.00% | 2.96% | 92.88% | NA |
| Indica Intermediate | 786 | 12.20% | 0.00% | 2.54% | 85.24% | NA |
| Temperate Japonica | 767 | 97.00% | 1.80% | 0.39% | 0.78% | NA |
| Tropical Japonica | 504 | 94.60% | 0.00% | 0.20% | 5.16% | NA |
| Japonica Intermediate | 241 | 96.70% | 0.80% | 0.41% | 2.07% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 61.10% | 1.10% | 0.00% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0116676710 | G -> A | LOC_Os01g29750.1 | upstream_gene_variant ; 4926.0bp to feature; MODIFIER | silent_mutation | Average:15.449; most accessible tissue: Callus, score: 63.424 | N | N | N | N |
| vg0116676710 | G -> A | LOC_Os01g29760.1 | intron_variant ; MODIFIER | silent_mutation | Average:15.449; most accessible tissue: Callus, score: 63.424 | N | N | N | N |
| vg0116676710 | G -> DEL | N | N | silent_mutation | Average:15.449; most accessible tissue: Callus, score: 63.424 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0116676710 | 1.02E-07 | 1.34E-09 | mr1038_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116676710 | NA | 3.12E-06 | mr1071_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116676710 | NA | 2.79E-06 | mr1080_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116676710 | NA | 3.10E-06 | mr1100_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116676710 | NA | 6.98E-06 | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116676710 | 7.78E-10 | 7.78E-10 | mr1389_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116676710 | NA | 5.60E-09 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116676710 | NA | 5.57E-06 | mr1619_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116676710 | 1.47E-07 | 1.26E-10 | mr1795_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116676710 | NA | 8.48E-10 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116676710 | NA | 2.22E-08 | mr1962_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |