\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0116676710:

Variant ID: vg0116676710 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 16676710
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCCAAGCTGTAGAGCGTGATTTCCTGCGTGCTGCGCCAGATGGCCATCCGCATGGATTTGAAGTCCCATAGGATGGGGCCTAGGGTGCTCAGTCAGGCC[G/A]
TGCCCAAGATGATGTCCACGGAACAGATGTCTAGGGCATAGCAGTCGATTGTGAACGGCTCGCCGTCGATCATGATGTCCAGGTCGTGGCAGAGGCCCGG

Reverse complement sequence

CCGGGCCTCTGCCACGACCTGGACATCATGATCGACGGCGAGCCGTTCACAATCGACTGCTATGCCCTAGACATCTGTTCCGTGGACATCATCTTGGGCA[C/T]
GGCCTGACTGAGCACCCTAGGCCCCATCCTATGGGACTTCAAATCCATGCGGATGGCCATCTGGCGCAGCACGCAGGAAATCACGCTCTACAGCTTGGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.10% 0.40% 1.63% 56.94% NA
All Indica  2759 8.60% 0.00% 2.54% 88.84% NA
All Japonica  1512 96.20% 1.10% 0.33% 2.45% NA
Aus  269 38.70% 0.00% 0.74% 60.59% NA
Indica I  595 2.70% 0.00% 2.52% 94.79% NA
Indica II  465 18.90% 0.00% 1.72% 79.35% NA
Indica III  913 4.20% 0.00% 2.96% 92.88% NA
Indica Intermediate  786 12.20% 0.00% 2.54% 85.24% NA
Temperate Japonica  767 97.00% 1.80% 0.39% 0.78% NA
Tropical Japonica  504 94.60% 0.00% 0.20% 5.16% NA
Japonica Intermediate  241 96.70% 0.80% 0.41% 2.07% NA
VI/Aromatic  96 93.80% 0.00% 0.00% 6.25% NA
Intermediate  90 61.10% 1.10% 0.00% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0116676710 G -> A LOC_Os01g29750.1 upstream_gene_variant ; 4926.0bp to feature; MODIFIER silent_mutation Average:15.449; most accessible tissue: Callus, score: 63.424 N N N N
vg0116676710 G -> A LOC_Os01g29760.1 intron_variant ; MODIFIER silent_mutation Average:15.449; most accessible tissue: Callus, score: 63.424 N N N N
vg0116676710 G -> DEL N N silent_mutation Average:15.449; most accessible tissue: Callus, score: 63.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0116676710 1.02E-07 1.34E-09 mr1038_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116676710 NA 3.12E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116676710 NA 2.79E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116676710 NA 3.10E-06 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116676710 NA 6.98E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116676710 7.78E-10 7.78E-10 mr1389_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116676710 NA 5.60E-09 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116676710 NA 5.57E-06 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116676710 1.47E-07 1.26E-10 mr1795_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116676710 NA 8.48E-10 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116676710 NA 2.22E-08 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251