\
| Variant ID: vg0116674582 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 16674582 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 119. )
CACCGGAGATACATCCCGACGACACGGTTGGCTGATTCCGACTGGCCGTCACTCTGCGGATGGAACGCCGAGCTGAGGTTGAGCTTCAACCCGGATAGGC[C/G]
AAAGAGCTCCTTCCAGAACATGCTCGTGAACACCGGGTCGCGGTCACTGACGATGGAGCTGGGAATGCCGTGGAGACGTACCACTTCGCCGAAGAATGCC
GGCATTCTTCGGCGAAGTGGTACGTCTCCACGGCATTCCCAGCTCCATCGTCAGTGACCGCGACCCGGTGTTCACGAGCATGTTCTGGAAGGAGCTCTTT[G/C]
GCCTATCCGGGTTGAAGCTCAACCTCAGCTCGGCGTTCCATCCGCAGAGTGACGGCCAGTCGGAATCAGCCAACCGTGTCGTCGGGATGTATCTCCGGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.00% | 10.20% | 5.23% | 58.51% | NA |
| All Indica | 2759 | 5.80% | 0.50% | 2.28% | 91.45% | NA |
| All Japonica | 1512 | 55.40% | 30.40% | 11.64% | 2.51% | NA |
| Aus | 269 | 37.50% | 0.40% | 1.49% | 60.59% | NA |
| Indica I | 595 | 1.20% | 0.50% | 3.03% | 95.29% | NA |
| Indica II | 465 | 14.40% | 1.10% | 1.51% | 83.01% | NA |
| Indica III | 913 | 2.00% | 0.20% | 1.86% | 95.95% | NA |
| Indica Intermediate | 786 | 8.50% | 0.50% | 2.67% | 88.30% | NA |
| Temperate Japonica | 767 | 29.30% | 51.20% | 18.51% | 0.91% | NA |
| Tropical Japonica | 504 | 90.70% | 1.40% | 2.78% | 5.16% | NA |
| Japonica Intermediate | 241 | 64.70% | 24.90% | 8.30% | 2.07% | NA |
| VI/Aromatic | 96 | 90.60% | 0.00% | 3.12% | 6.25% | NA |
| Intermediate | 90 | 50.00% | 10.00% | 1.11% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0116674582 | C -> G | LOC_Os01g29760.1 | missense_variant ; p.Gly968Arg; MODERATE | nonsynonymous_codon ; G968R | Average:15.102; most accessible tissue: Callus, score: 53.343 | benign |
-1.424 |
TOLERATED | 1.00 |
| vg0116674582 | C -> DEL | LOC_Os01g29760.1 | N | frameshift_variant | Average:15.102; most accessible tissue: Callus, score: 53.343 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0116674582 | NA | 5.20E-06 | mr1006 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116674582 | NA | 1.01E-06 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116674582 | NA | 1.84E-06 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116674582 | NA | 3.23E-12 | mr1034 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116674582 | NA | 7.37E-07 | mr1034 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116674582 | NA | 6.19E-07 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116674582 | NA | 2.69E-08 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116674582 | NA | 2.24E-07 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116674582 | NA | 1.40E-06 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116674582 | NA | 1.06E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116674582 | NA | 8.97E-06 | mr1555 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116674582 | NA | 1.89E-07 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116674582 | NA | 2.23E-06 | mr1576 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116674582 | NA | 2.18E-07 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116674582 | NA | 5.21E-06 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116674582 | 2.49E-06 | 2.49E-06 | mr1824 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |