\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0116674582:

Variant ID: vg0116674582 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 16674582
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


CACCGGAGATACATCCCGACGACACGGTTGGCTGATTCCGACTGGCCGTCACTCTGCGGATGGAACGCCGAGCTGAGGTTGAGCTTCAACCCGGATAGGC[C/G]
AAAGAGCTCCTTCCAGAACATGCTCGTGAACACCGGGTCGCGGTCACTGACGATGGAGCTGGGAATGCCGTGGAGACGTACCACTTCGCCGAAGAATGCC

Reverse complement sequence

GGCATTCTTCGGCGAAGTGGTACGTCTCCACGGCATTCCCAGCTCCATCGTCAGTGACCGCGACCCGGTGTTCACGAGCATGTTCTGGAAGGAGCTCTTT[G/C]
GCCTATCCGGGTTGAAGCTCAACCTCAGCTCGGCGTTCCATCCGCAGAGTGACGGCCAGTCGGAATCAGCCAACCGTGTCGTCGGGATGTATCTCCGGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.00% 10.20% 5.23% 58.51% NA
All Indica  2759 5.80% 0.50% 2.28% 91.45% NA
All Japonica  1512 55.40% 30.40% 11.64% 2.51% NA
Aus  269 37.50% 0.40% 1.49% 60.59% NA
Indica I  595 1.20% 0.50% 3.03% 95.29% NA
Indica II  465 14.40% 1.10% 1.51% 83.01% NA
Indica III  913 2.00% 0.20% 1.86% 95.95% NA
Indica Intermediate  786 8.50% 0.50% 2.67% 88.30% NA
Temperate Japonica  767 29.30% 51.20% 18.51% 0.91% NA
Tropical Japonica  504 90.70% 1.40% 2.78% 5.16% NA
Japonica Intermediate  241 64.70% 24.90% 8.30% 2.07% NA
VI/Aromatic  96 90.60% 0.00% 3.12% 6.25% NA
Intermediate  90 50.00% 10.00% 1.11% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0116674582 C -> G LOC_Os01g29760.1 missense_variant ; p.Gly968Arg; MODERATE nonsynonymous_codon ; G968R Average:15.102; most accessible tissue: Callus, score: 53.343 benign -1.424 TOLERATED 1.00
vg0116674582 C -> DEL LOC_Os01g29760.1 N frameshift_variant Average:15.102; most accessible tissue: Callus, score: 53.343 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0116674582 NA 5.20E-06 mr1006 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116674582 NA 1.01E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116674582 NA 1.84E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116674582 NA 3.23E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116674582 NA 7.37E-07 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116674582 NA 6.19E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116674582 NA 2.69E-08 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116674582 NA 2.24E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116674582 NA 1.40E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116674582 NA 1.06E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116674582 NA 8.97E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116674582 NA 1.89E-07 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116674582 NA 2.23E-06 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116674582 NA 2.18E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116674582 NA 5.21E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116674582 2.49E-06 2.49E-06 mr1824 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251