\
| Variant ID: vg0116413317 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 16413317 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.54, A: 0.46, others allele: 0.00, population size: 108. )
ACGCTGTTGTCGGTGAAACTGGATGTCATAGTAGTAGAACCTTGAGCACCAAGTCCCCCTACCTGGCACGCCACTGTCGACGGGGGATACCCGTAGACCG[A/G]
ATATAGAGGGTATTGGGGTACGCTGGTACGAGGATCTACGTAGTACGACATCAAGCAAACAGGAAACAGGGATTATACTGGTTCAGGCCCCTTGGCAGGT
ACCTGCCAAGGGGCCTGAACCAGTATAATCCCTGTTTCCTGTTTGCTTGATGTCGTACTACGTAGATCCTCGTACCAGCGTACCCCAATACCCTCTATAT[T/C]
CGGTCTACGGGTATCCCCCGTCGACAGTGGCGTGCCAGGTAGGGGGACTTGGTGCTCAAGGTTCTACTACTATGACATCCAGTTTCACCGACAACAGCGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.00% | 6.30% | 34.26% | 21.50% | NA |
| All Indica | 2759 | 4.10% | 9.10% | 53.14% | 33.60% | NA |
| All Japonica | 1512 | 95.90% | 1.70% | 2.05% | 0.33% | NA |
| Aus | 269 | 33.10% | 4.80% | 34.94% | 27.14% | NA |
| Indica I | 595 | 1.20% | 4.70% | 66.89% | 27.23% | NA |
| Indica II | 465 | 4.90% | 8.60% | 41.29% | 45.16% | NA |
| Indica III | 913 | 3.70% | 12.80% | 47.32% | 36.14% | NA |
| Indica Intermediate | 786 | 6.40% | 8.50% | 56.49% | 28.63% | NA |
| Temperate Japonica | 767 | 98.80% | 0.40% | 0.65% | 0.13% | NA |
| Tropical Japonica | 504 | 94.40% | 0.60% | 4.56% | 0.40% | NA |
| Japonica Intermediate | 241 | 89.60% | 8.30% | 1.24% | 0.83% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 5.21% | 1.04% | NA |
| Intermediate | 90 | 57.80% | 5.60% | 25.56% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0116413317 | A -> G | LOC_Os01g29270.1 | missense_variant ; p.Ser18Pro; MODERATE | nonsynonymous_codon ; S18L | Average:57.057; most accessible tissue: Minghui63 flag leaf, score: 79.383 | benign |
1.307 |
DELETERIOUS | 0.05 |
| vg0116413317 | A -> G | LOC_Os01g29270.1 | missense_variant ; p.Ser18Pro; MODERATE | nonsynonymous_codon ; S18P | Average:57.057; most accessible tissue: Minghui63 flag leaf, score: 79.383 | benign |
-0.47 |
TOLERATED | 1.00 |
| vg0116413317 | A -> DEL | LOC_Os01g29270.1 | N | frameshift_variant | Average:57.057; most accessible tissue: Minghui63 flag leaf, score: 79.383 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0116413317 | NA | 3.62E-15 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116413317 | NA | 9.43E-11 | mr1172 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116413317 | NA | 6.41E-15 | mr1228 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116413317 | NA | 3.07E-28 | mr1298 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116413317 | NA | 7.16E-16 | mr1323 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116413317 | NA | 1.89E-09 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116413317 | 1.11E-06 | NA | mr1414 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116413317 | NA | 2.37E-23 | mr1571 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116413317 | NA | 4.78E-20 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116413317 | NA | 3.91E-11 | mr1623 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116413317 | NA | 4.58E-19 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116413317 | NA | 3.62E-06 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116413317 | NA | 3.05E-12 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116413317 | NA | 1.75E-18 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116413317 | 9.08E-06 | NA | mr1882 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116413317 | NA | 3.73E-22 | mr1943 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116413317 | NA | 1.72E-48 | mr1519_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116413317 | NA | 4.93E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116413317 | NA | 5.67E-25 | mr1916_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |