\
| Variant ID: vg0116370525 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 16370525 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATCAACTGTGCAGATTGCCGGTATTAATATATTGTTTGAATATAATGCTCAGATCTACTTTAGATATGCCATTCAGAGTTCCCTCAATTAATAATGGTGG[T/C]
GCTTGTGTGTTTGGATGGTTATGGATTATTATATTATATTTAATATTGTTGAAAACTCAAAATGAGTAACTAAAGTGAAGTAACATGTGATGCAATGTAC
GTACATTGCATCACATGTTACTTCACTTTAGTTACTCATTTTGAGTTTTCAACAATATTAAATATAATATAATAATCCATAACCATCCAAACACACAAGC[A/G]
CCACCATTATTAATTGAGGGAACTCTGAATGGCATATCTAAAGTAGATCTGAGCATTATATTCAAACAATATATTAATACCGGCAATCTGCACAGTTGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.60% | 9.90% | 2.52% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 62.50% | 29.90% | 7.61% | 0.00% | NA |
| Aus | 269 | 98.50% | 0.70% | 0.74% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 37.30% | 51.40% | 11.34% | 0.00% | NA |
| Tropical Japonica | 504 | 96.20% | 0.60% | 3.17% | 0.00% | NA |
| Japonica Intermediate | 241 | 72.20% | 22.80% | 4.98% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 6.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0116370525 | T -> C | LOC_Os01g29220.1 | downstream_gene_variant ; 668.0bp to feature; MODIFIER | silent_mutation | Average:48.003; most accessible tissue: Callus, score: 67.104 | N | N | N | N |
| vg0116370525 | T -> C | LOC_Os01g29220-LOC_Os01g29230 | intergenic_region ; MODIFIER | silent_mutation | Average:48.003; most accessible tissue: Callus, score: 67.104 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0116370525 | NA | 1.49E-07 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116370525 | NA | 2.10E-06 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116370525 | NA | 1.72E-06 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116370525 | NA | 5.49E-13 | mr1034 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116370525 | NA | 4.99E-07 | mr1034 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116370525 | NA | 9.77E-06 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116370525 | 5.82E-06 | 5.55E-07 | mr1170 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116370525 | NA | 3.06E-07 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116370525 | NA | 1.11E-07 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116370525 | NA | 5.36E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116370525 | NA | 2.42E-06 | mr1555 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116370525 | NA | 7.63E-07 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116370525 | NA | 1.26E-06 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |