\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0116143146:

Variant ID: vg0116143146 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 16143146
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:


GACTAGAACCAGCTATCAAGAATGGGAGGGCTTTCCACTGCTATCAAGAACCAACTGAGCTTCAACAAGATGCTGGAAACTCAAATAGCTCAGTTGGCGG[T/C]
TGTTGTTCCCTCTGCCAAGACAGGGAAGATTCTAGGACAACCAAAACCCTCTTTGGAAAATGTTAATGTGGTGACCACGAGATAGGCAAGACCACTTGTG

Reverse complement sequence

CACAAGTGGTCTTGCCTATCTCGTGGTCACCACATTAACATTTTCCAAAGAGGGTTTTGGTTGTCCTAGAATCTTCCCTGTCTTGGCAGAGGGAACAACA[A/G]
CCGCCAACTGAGCTATTTGAGTTTCCAGCATCTTGTTGAAGCTCAGTTGGTTCTTGATAGCAGTGGAAAGCCCTCCCATTCTTGATAGCTGGTTCTAGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.40% 8.70% 1.93% 0.00% NA
All Indica  2759 99.70% 0.30% 0.07% 0.00% NA
All Japonica  1512 68.20% 26.10% 5.69% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.30% 0.13% 0.00% NA
Temperate Japonica  767 45.20% 46.20% 8.60% 0.00% NA
Tropical Japonica  504 96.60% 1.40% 1.98% 0.00% NA
Japonica Intermediate  241 81.70% 14.10% 4.15% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 92.20% 6.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0116143146 T -> C LOC_Os01g28810.1 upstream_gene_variant ; 2012.0bp to feature; MODIFIER silent_mutation Average:53.186; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg0116143146 T -> C LOC_Os01g28820.1 upstream_gene_variant ; 1684.0bp to feature; MODIFIER silent_mutation Average:53.186; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg0116143146 T -> C LOC_Os01g28830.1 downstream_gene_variant ; 2660.0bp to feature; MODIFIER silent_mutation Average:53.186; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg0116143146 T -> C LOC_Os01g28810-LOC_Os01g28820 intergenic_region ; MODIFIER silent_mutation Average:53.186; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0116143146 NA 4.54E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0116143146 NA 7.62E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146 NA 9.00E-07 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146 NA 5.34E-08 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146 NA 5.01E-06 mr1170 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146 NA 2.62E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146 NA 5.03E-07 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146 NA 3.70E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146 NA 4.62E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146 NA 7.15E-06 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146 NA 7.81E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146 NA 3.51E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146 NA 1.22E-07 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146 8.35E-06 1.07E-08 mr1555 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146 NA 1.38E-06 mr1555 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146 NA 3.52E-07 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146 1.65E-06 NA mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146 8.51E-06 4.07E-11 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146 NA 4.78E-06 mr1775 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146 NA 4.87E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146 NA 4.45E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146 NA 2.51E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146 NA 5.95E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146 NA 4.98E-08 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251