Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0116143146:

Variant ID: vg0116143146 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 16143146
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:

GACTAGAACCAGCTATCAAGAATGGGAGGGCTTTCCACTGCTATCAAGAACCAACTGAGCTTCAACAAGATGCTGGAAACTCAAATAGCTCAGTTGGCGG[T/C]
TGTTGTTCCCTCTGCCAAGACAGGGAAGATTCTAGGACAACCAAAACCCTCTTTGGAAAATGTTAATGTGGTGACCACGAGATAGGCAAGACCACTTGTG

Reverse complement sequence

CACAAGTGGTCTTGCCTATCTCGTGGTCACCACATTAACATTTTCCAAAGAGGGTTTTGGTTGTCCTAGAATCTTCCCTGTCTTGGCAGAGGGAACAACA[A/G]
CCGCCAACTGAGCTATTTGAGTTTCCAGCATCTTGTTGAAGCTCAGTTGGTTCTTGATAGCAGTGGAAAGCCCTCCCATTCTTGATAGCTGGTTCTAGTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.40%	8.70%	1.93%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.07%	0.00%	NA
All Japonica	1512	68.20%	26.10%	5.69%	0.00%	NA
Aus	269	99.30%	0.40%	0.37%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.30%	0.13%	0.00%	NA
Temperate Japonica	767	45.20%	46.20%	8.60%	0.00%	NA
Tropical Japonica	504	96.60%	1.40%	1.98%	0.00%	NA
Japonica Intermediate	241	81.70%	14.10%	4.15%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	92.20%	6.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0116143146	T -> C	LOC_Os01g28810.1	upstream_gene_variant ; 2012.0bp to feature; MODIFIER	silent_mutation	Average:53.186; most accessible tissue: Zhenshan97 young leaf, score: 71.923	N	N	N	N
vg0116143146	T -> C	LOC_Os01g28820.1	upstream_gene_variant ; 1684.0bp to feature; MODIFIER	silent_mutation	Average:53.186; most accessible tissue: Zhenshan97 young leaf, score: 71.923	N	N	N	N
vg0116143146	T -> C	LOC_Os01g28830.1	downstream_gene_variant ; 2660.0bp to feature; MODIFIER	silent_mutation	Average:53.186; most accessible tissue: Zhenshan97 young leaf, score: 71.923	N	N	N	N
vg0116143146	T -> C	LOC_Os01g28810-LOC_Os01g28820	intergenic_region ; MODIFIER	silent_mutation	Average:53.186; most accessible tissue: Zhenshan97 young leaf, score: 71.923	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0116143146	NA	4.54E-14	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0116143146	NA	7.62E-06	mr1069	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146	NA	9.00E-07	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146	NA	5.34E-08	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146	NA	5.01E-06	mr1170	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146	NA	2.62E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146	NA	5.03E-07	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146	NA	3.70E-06	mr1205	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146	NA	4.62E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146	NA	7.15E-06	mr1271	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146	NA	7.81E-07	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146	NA	3.51E-10	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146	NA	1.22E-07	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146	8.35E-06	1.07E-08	mr1555	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146	NA	1.38E-06	mr1555	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146	NA	3.52E-07	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146	1.65E-06	NA	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146	8.51E-06	4.07E-11	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146	NA	4.78E-06	mr1775	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146	NA	4.87E-07	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146	NA	4.45E-06	mr1977	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146	NA	2.51E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146	NA	5.95E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116143146	NA	4.98E-08	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251