\
| Variant ID: vg0116143146 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 16143146 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 331. )
GACTAGAACCAGCTATCAAGAATGGGAGGGCTTTCCACTGCTATCAAGAACCAACTGAGCTTCAACAAGATGCTGGAAACTCAAATAGCTCAGTTGGCGG[T/C]
TGTTGTTCCCTCTGCCAAGACAGGGAAGATTCTAGGACAACCAAAACCCTCTTTGGAAAATGTTAATGTGGTGACCACGAGATAGGCAAGACCACTTGTG
CACAAGTGGTCTTGCCTATCTCGTGGTCACCACATTAACATTTTCCAAAGAGGGTTTTGGTTGTCCTAGAATCTTCCCTGTCTTGGCAGAGGGAACAACA[A/G]
CCGCCAACTGAGCTATTTGAGTTTCCAGCATCTTGTTGAAGCTCAGTTGGTTCTTGATAGCAGTGGAAAGCCCTCCCATTCTTGATAGCTGGTTCTAGTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.40% | 8.70% | 1.93% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 68.20% | 26.10% | 5.69% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 45.20% | 46.20% | 8.60% | 0.00% | NA |
| Tropical Japonica | 504 | 96.60% | 1.40% | 1.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 81.70% | 14.10% | 4.15% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 6.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0116143146 | T -> C | LOC_Os01g28810.1 | upstream_gene_variant ; 2012.0bp to feature; MODIFIER | silent_mutation | Average:53.186; most accessible tissue: Zhenshan97 young leaf, score: 71.923 | N | N | N | N |
| vg0116143146 | T -> C | LOC_Os01g28820.1 | upstream_gene_variant ; 1684.0bp to feature; MODIFIER | silent_mutation | Average:53.186; most accessible tissue: Zhenshan97 young leaf, score: 71.923 | N | N | N | N |
| vg0116143146 | T -> C | LOC_Os01g28830.1 | downstream_gene_variant ; 2660.0bp to feature; MODIFIER | silent_mutation | Average:53.186; most accessible tissue: Zhenshan97 young leaf, score: 71.923 | N | N | N | N |
| vg0116143146 | T -> C | LOC_Os01g28810-LOC_Os01g28820 | intergenic_region ; MODIFIER | silent_mutation | Average:53.186; most accessible tissue: Zhenshan97 young leaf, score: 71.923 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0116143146 | NA | 4.54E-14 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0116143146 | NA | 7.62E-06 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116143146 | NA | 9.00E-07 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116143146 | NA | 5.34E-08 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116143146 | NA | 5.01E-06 | mr1170 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116143146 | NA | 2.62E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116143146 | NA | 5.03E-07 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116143146 | NA | 3.70E-06 | mr1205 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116143146 | NA | 4.62E-07 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116143146 | NA | 7.15E-06 | mr1271 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116143146 | NA | 7.81E-07 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116143146 | NA | 3.51E-10 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116143146 | NA | 1.22E-07 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116143146 | 8.35E-06 | 1.07E-08 | mr1555 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116143146 | NA | 1.38E-06 | mr1555 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116143146 | NA | 3.52E-07 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116143146 | 1.65E-06 | NA | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116143146 | 8.51E-06 | 4.07E-11 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116143146 | NA | 4.78E-06 | mr1775 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116143146 | NA | 4.87E-07 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116143146 | NA | 4.45E-06 | mr1977 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116143146 | NA | 2.51E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116143146 | NA | 5.95E-06 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0116143146 | NA | 4.98E-08 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |