Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0116085125:

Variant ID: vg0116085125 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 16085125
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:

TGTGGGTATTTTGTATATACTAAGTTTTGTTAATTAGGGGACATAAACAATACTAAAGTTATATATGAGAATTCAAGCATTAAAAATACACTTCATAACA[T/A]
GAACGTACTTAACAAAAATGTACTTTAGTCTATGGTGCTTAAATATTTATAAATTCTCTAAACATACTAATTATTTCTGCTCTTATTTCAAACTAAATTC

Reverse complement sequence

GAATTTAGTTTGAAATAAGAGCAGAAATAATTAGTATGTTTAGAGAATTTATAAATATTTAAGCACCATAGACTAAAGTACATTTTTGTTAAGTACGTTC[A/T]
TGTTATGAAGTGTATTTTTAATGCTTGAATTCTCATATATAACTTTAGTATTGTTTATGTCCCCTAATTAACAAAACTTAGTATATACAAAATACCCACA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.20%	14.20%	25.86%	35.74%	NA
All Indica	2759	5.50%	0.80%	39.51%	54.11%	NA
All Japonica	1512	50.70%	41.50%	5.29%	2.51%	NA
Aus	269	38.30%	0.70%	11.15%	49.81%	NA
Indica I	595	0.70%	0.70%	17.48%	81.18%	NA
Indica II	465	14.60%	2.20%	48.82%	34.41%	NA
Indica III	913	2.10%	0.10%	52.35%	45.45%	NA
Indica Intermediate	786	7.90%	1.00%	35.75%	55.34%	NA
Temperate Japonica	767	20.60%	71.40%	7.04%	0.91%	NA
Tropical Japonica	504	89.70%	1.80%	3.37%	5.16%	NA
Japonica Intermediate	241	64.70%	29.50%	3.73%	2.07%	NA
VI/Aromatic	96	92.70%	0.00%	2.08%	5.21%	NA
Intermediate	90	36.70%	20.00%	22.22%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0116085125	T -> A	LOC_Os01g28730.1	upstream_gene_variant ; 1498.0bp to feature; MODIFIER	silent_mutation	Average:7.986; most accessible tissue: Minghui63 flag leaf, score: 15.952	N	N	N	N
vg0116085125	T -> A	LOC_Os01g28720.1	downstream_gene_variant ; 3317.0bp to feature; MODIFIER	silent_mutation	Average:7.986; most accessible tissue: Minghui63 flag leaf, score: 15.952	N	N	N	N
vg0116085125	T -> A	LOC_Os01g28740.1	downstream_gene_variant ; 4439.0bp to feature; MODIFIER	silent_mutation	Average:7.986; most accessible tissue: Minghui63 flag leaf, score: 15.952	N	N	N	N
vg0116085125	T -> A	LOC_Os01g28720-LOC_Os01g28730	intergenic_region ; MODIFIER	silent_mutation	Average:7.986; most accessible tissue: Minghui63 flag leaf, score: 15.952	N	N	N	N
vg0116085125	T -> DEL	N	N	silent_mutation	Average:7.986; most accessible tissue: Minghui63 flag leaf, score: 15.952	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0116085125	NA	2.90E-11	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0116085125	NA	2.37E-07	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116085125	NA	2.33E-07	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116085125	NA	2.78E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116085125	NA	7.97E-06	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116085125	NA	1.58E-08	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116085125	NA	2.69E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116085125	NA	9.41E-06	mr1205	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116085125	NA	1.03E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116085125	NA	5.43E-07	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116085125	NA	2.82E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116085125	NA	2.83E-07	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116085125	9.60E-06	1.27E-07	mr1826	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116085125	NA	7.04E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116085125	NA	4.12E-07	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251