\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0116074965:

Variant ID: vg0116074965 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 16074965
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, A: 0.23, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


TTTATTGTTCTCCTAAAAGATCATCTTAAAAGTATCAAGGTCAATTTCTATAGGTACGTAGCCCTCATATGCATGTTAAGAGAAATCAATTAAGTTGATA[A/G]
AGAGTCGTTAGATGCCTAATGGGATATAAGTAATAGATAGAGGTCCATTTGTGTTTTTTGTTTGCCCATATAAATAACTTTAATTTTAATTGTCAAGGAG

Reverse complement sequence

CTCCTTGACAATTAAAATTAAAGTTATTTATATGGGCAAACAAAAAACACAAATGGACCTCTATCTATTACTTATATCCCATTAGGCATCTAACGACTCT[T/C]
TATCAACTTAATTGATTTCTCTTAACATGCATATGAGGGCTACGTACCTATAGAAATTGACCTTGATACTTTTAAGATGATCTTTTAGGAGAACAATAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.10% 36.60% 0.21% 0.00% NA
All Indica  2759 97.40% 2.40% 0.29% 0.00% NA
All Japonica  1512 4.20% 95.80% 0.00% 0.00% NA
Aus  269 68.40% 30.90% 0.74% 0.00% NA
Indica I  595 98.80% 0.50% 0.67% 0.00% NA
Indica II  465 95.30% 4.50% 0.22% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 95.20% 4.50% 0.38% 0.00% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 5.60% 94.40% 0.00% 0.00% NA
Japonica Intermediate  241 10.40% 89.60% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 50.00% 50.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0116074965 A -> G LOC_Os01g28700.1 upstream_gene_variant ; 3535.0bp to feature; MODIFIER silent_mutation Average:25.764; most accessible tissue: Minghui63 flag leaf, score: 43.614 N N N N
vg0116074965 A -> G LOC_Os01g28710.1 downstream_gene_variant ; 4328.0bp to feature; MODIFIER silent_mutation Average:25.764; most accessible tissue: Minghui63 flag leaf, score: 43.614 N N N N
vg0116074965 A -> G LOC_Os01g28700-LOC_Os01g28710 intergenic_region ; MODIFIER silent_mutation Average:25.764; most accessible tissue: Minghui63 flag leaf, score: 43.614 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0116074965 NA 8.25E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116074965 NA 6.66E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116074965 NA 4.06E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116074965 NA 1.79E-31 mr1298 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116074965 NA 1.52E-40 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116074965 NA 1.34E-50 mr1519 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116074965 NA 1.18E-47 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116074965 NA 2.68E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116074965 NA 6.36E-22 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116074965 NA 4.64E-28 mr1731 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116074965 NA 4.73E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116074965 9.26E-07 1.07E-53 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116074965 NA 1.86E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116074965 NA 3.28E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116074965 NA 7.23E-23 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116074965 NA 2.09E-17 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116074965 NA 2.12E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116074965 NA 1.59E-14 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251