Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115989167:

Variant ID: vg0115989167 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 15989167
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTTGTATGAACCCCTTTGCCTCACGATATCGATTAAGCTCAAGGCTAGATATGTGCCATCCTCTAATAGCTCAATCATTCACTCGAACCTGTTGATAGA[C/T]
TATATAACTTATGATTGACTCCTCAATCACCTTTGGCATGGCCATACACTTCCATAATCTACAACATCGAGGGGTCCAGAGATATCTCTCCATAGGAGGG

Reverse complement sequence

CCCTCCTATGGAGAGATATCTCTGGACCCCTCGATGTTGTAGATTATGGAAGTGTATGGCCATGCCAAAGGTGATTGAGGAGTCAATCATAAGTTATATA[G/A]
TCTATCAACAGGTTCGAGTGAATGATTGAGCTATTAGAGGATGGCACATATCTAGCCTTGAGCTTAATCGATATCGTGAGGCAAAGGGGTTCATACAAGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.00%	2.50%	2.24%	57.28%	NA
All Indica	2759	4.20%	3.30%	2.83%	89.67%	NA
All Japonica	1512	96.00%	0.10%	0.93%	2.91%	NA
Aus	269	33.10%	7.10%	3.72%	56.13%	NA
Indica I	595	3.00%	0.00%	3.03%	93.95%	NA
Indica II	465	4.90%	11.60%	3.01%	80.43%	NA
Indica III	913	2.10%	1.00%	3.18%	93.76%	NA
Indica Intermediate	786	7.00%	3.70%	2.16%	87.15%	NA
Temperate Japonica	767	98.70%	0.00%	0.26%	1.04%	NA
Tropical Japonica	504	94.40%	0.00%	0.40%	5.16%	NA
Japonica Intermediate	241	90.90%	0.80%	4.15%	4.15%	NA
VI/Aromatic	96	93.80%	0.00%	0.00%	6.25%	NA
Intermediate	90	56.70%	3.30%	4.44%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0115989167	C -> T	LOC_Os01g28550.1	upstream_gene_variant ; 3058.0bp to feature; MODIFIER	silent_mutation	Average:7.088; most accessible tissue: Callus, score: 13.757	N	N	N	N
vg0115989167	C -> T	LOC_Os01g28560.1	upstream_gene_variant ; 1622.0bp to feature; MODIFIER	silent_mutation	Average:7.088; most accessible tissue: Callus, score: 13.757	N	N	N	N
vg0115989167	C -> T	LOC_Os01g28580.1	upstream_gene_variant ; 3592.0bp to feature; MODIFIER	silent_mutation	Average:7.088; most accessible tissue: Callus, score: 13.757	N	N	N	N
vg0115989167	C -> T	LOC_Os01g28570.1	downstream_gene_variant ; 1408.0bp to feature; MODIFIER	silent_mutation	Average:7.088; most accessible tissue: Callus, score: 13.757	N	N	N	N
vg0115989167	C -> T	LOC_Os01g28560-LOC_Os01g28570	intergenic_region ; MODIFIER	silent_mutation	Average:7.088; most accessible tissue: Callus, score: 13.757	N	N	N	N
vg0115989167	C -> DEL	N	N	silent_mutation	Average:7.088; most accessible tissue: Callus, score: 13.757	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0115989167	NA	7.19E-15	mr1228	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167	NA	1.84E-28	mr1298	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167	NA	2.38E-15	mr1323	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167	NA	8.38E-48	mr1519	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167	NA	3.95E-21	mr1698	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167	NA	3.76E-25	mr1731	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167	NA	1.69E-17	mr1281_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167	NA	2.88E-10	mr1398_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167	9.56E-06	1.48E-50	mr1519_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167	6.83E-06	8.71E-09	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167	NA	4.08E-13	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167	NA	1.77E-25	mr1708_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167	NA	9.05E-18	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167	NA	4.00E-15	mr1717_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167	8.32E-07	4.45E-09	mr1748_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167	NA	7.10E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167	6.22E-08	1.25E-17	mr1770_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167	NA	3.99E-08	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167	NA	5.85E-08	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167	NA	3.13E-06	mr1872_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167	NA	7.32E-25	mr1916_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167	NA	3.91E-10	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167	NA	3.91E-10	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251