\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115989167:

Variant ID: vg0115989167 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 15989167
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTTGTATGAACCCCTTTGCCTCACGATATCGATTAAGCTCAAGGCTAGATATGTGCCATCCTCTAATAGCTCAATCATTCACTCGAACCTGTTGATAGA[C/T]
TATATAACTTATGATTGACTCCTCAATCACCTTTGGCATGGCCATACACTTCCATAATCTACAACATCGAGGGGTCCAGAGATATCTCTCCATAGGAGGG

Reverse complement sequence

CCCTCCTATGGAGAGATATCTCTGGACCCCTCGATGTTGTAGATTATGGAAGTGTATGGCCATGCCAAAGGTGATTGAGGAGTCAATCATAAGTTATATA[G/A]
TCTATCAACAGGTTCGAGTGAATGATTGAGCTATTAGAGGATGGCACATATCTAGCCTTGAGCTTAATCGATATCGTGAGGCAAAGGGGTTCATACAAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.00% 2.50% 2.24% 57.28% NA
All Indica  2759 4.20% 3.30% 2.83% 89.67% NA
All Japonica  1512 96.00% 0.10% 0.93% 2.91% NA
Aus  269 33.10% 7.10% 3.72% 56.13% NA
Indica I  595 3.00% 0.00% 3.03% 93.95% NA
Indica II  465 4.90% 11.60% 3.01% 80.43% NA
Indica III  913 2.10% 1.00% 3.18% 93.76% NA
Indica Intermediate  786 7.00% 3.70% 2.16% 87.15% NA
Temperate Japonica  767 98.70% 0.00% 0.26% 1.04% NA
Tropical Japonica  504 94.40% 0.00% 0.40% 5.16% NA
Japonica Intermediate  241 90.90% 0.80% 4.15% 4.15% NA
VI/Aromatic  96 93.80% 0.00% 0.00% 6.25% NA
Intermediate  90 56.70% 3.30% 4.44% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0115989167 C -> T LOC_Os01g28550.1 upstream_gene_variant ; 3058.0bp to feature; MODIFIER silent_mutation Average:7.088; most accessible tissue: Callus, score: 13.757 N N N N
vg0115989167 C -> T LOC_Os01g28560.1 upstream_gene_variant ; 1622.0bp to feature; MODIFIER silent_mutation Average:7.088; most accessible tissue: Callus, score: 13.757 N N N N
vg0115989167 C -> T LOC_Os01g28580.1 upstream_gene_variant ; 3592.0bp to feature; MODIFIER silent_mutation Average:7.088; most accessible tissue: Callus, score: 13.757 N N N N
vg0115989167 C -> T LOC_Os01g28570.1 downstream_gene_variant ; 1408.0bp to feature; MODIFIER silent_mutation Average:7.088; most accessible tissue: Callus, score: 13.757 N N N N
vg0115989167 C -> T LOC_Os01g28560-LOC_Os01g28570 intergenic_region ; MODIFIER silent_mutation Average:7.088; most accessible tissue: Callus, score: 13.757 N N N N
vg0115989167 C -> DEL N N silent_mutation Average:7.088; most accessible tissue: Callus, score: 13.757 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0115989167 NA 7.19E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167 NA 1.84E-28 mr1298 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167 NA 2.38E-15 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167 NA 8.38E-48 mr1519 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167 NA 3.95E-21 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167 NA 3.76E-25 mr1731 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167 NA 1.69E-17 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167 NA 2.88E-10 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167 9.56E-06 1.48E-50 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167 6.83E-06 8.71E-09 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167 NA 4.08E-13 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167 NA 1.77E-25 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167 NA 9.05E-18 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167 NA 4.00E-15 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167 8.32E-07 4.45E-09 mr1748_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167 NA 7.10E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167 6.22E-08 1.25E-17 mr1770_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167 NA 3.99E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167 NA 5.85E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167 NA 3.13E-06 mr1872_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167 NA 7.32E-25 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167 NA 3.91E-10 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115989167 NA 3.91E-10 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251