\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115947503:

Variant ID: vg0115947503 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 15947503
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, G: 0.04, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


GGAAATTTTTGGCTCTCAAAAATTGGAGAAGTTAACCTCTAACTATTTTGACAAGAAATTTTAAGTCCTAGAATTTCGGGTACGTTACAATATGATTTGA[T/G]
TGTCATGATTATTTGAAATACTTATCAGAAATTATGGTATGGTATTCCCAAATAAAGTACTGTAGAGATAAAAGGGAGACGTGGGGGTGCCTACATGCCT

Reverse complement sequence

AGGCATGTAGGCACCCCCACGTCTCCCTTTTATCTCTACAGTACTTTATTTGGGAATACCATACCATAATTTCTGATAAGTATTTCAAATAATCATGACA[A/C]
TCAAATCATATTGTAACGTACCCGAAATTCTAGGACTTAAAATTTCTTGTCAAAATAGTTAGAGGTTAACTTCTCCAATTTTTGAGAGCCAAAAATTTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.40% 37.70% 0.19% 12.67% NA
All Indica  2759 75.40% 3.00% 0.33% 21.28% NA
All Japonica  1512 2.40% 97.40% 0.00% 0.20% NA
Aus  269 68.00% 32.00% 0.00% 0.00% NA
Indica I  595 50.90% 1.20% 0.67% 47.23% NA
Indica II  465 67.50% 4.70% 0.43% 27.31% NA
Indica III  913 95.90% 1.20% 0.11% 2.74% NA
Indica Intermediate  786 74.60% 5.60% 0.25% 19.59% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 5.00% 94.60% 0.00% 0.40% NA
Japonica Intermediate  241 1.70% 97.90% 0.00% 0.41% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 33.30% 56.70% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0115947503 T -> G LOC_Os01g28474.1 upstream_gene_variant ; 1273.0bp to feature; MODIFIER silent_mutation Average:35.554; most accessible tissue: Zhenshan97 young leaf, score: 45.96 N N N N
vg0115947503 T -> G LOC_Os01g28450-LOC_Os01g28474 intergenic_region ; MODIFIER silent_mutation Average:35.554; most accessible tissue: Zhenshan97 young leaf, score: 45.96 N N N N
vg0115947503 T -> DEL N N silent_mutation Average:35.554; most accessible tissue: Zhenshan97 young leaf, score: 45.96 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0115947503 NA 6.54E-10 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115947503 7.87E-07 NA mr1923 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115947503 8.93E-07 6.84E-07 mr1923 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115947503 NA 1.87E-17 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115947503 NA 2.28E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115947503 NA 1.50E-12 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115947503 NA 2.73E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251