\
| Variant ID: vg0115947503 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 15947503 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, G: 0.04, others allele: 0.00, population size: 66. )
GGAAATTTTTGGCTCTCAAAAATTGGAGAAGTTAACCTCTAACTATTTTGACAAGAAATTTTAAGTCCTAGAATTTCGGGTACGTTACAATATGATTTGA[T/G]
TGTCATGATTATTTGAAATACTTATCAGAAATTATGGTATGGTATTCCCAAATAAAGTACTGTAGAGATAAAAGGGAGACGTGGGGGTGCCTACATGCCT
AGGCATGTAGGCACCCCCACGTCTCCCTTTTATCTCTACAGTACTTTATTTGGGAATACCATACCATAATTTCTGATAAGTATTTCAAATAATCATGACA[A/C]
TCAAATCATATTGTAACGTACCCGAAATTCTAGGACTTAAAATTTCTTGTCAAAATAGTTAGAGGTTAACTTCTCCAATTTTTGAGAGCCAAAAATTTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.40% | 37.70% | 0.19% | 12.67% | NA |
| All Indica | 2759 | 75.40% | 3.00% | 0.33% | 21.28% | NA |
| All Japonica | 1512 | 2.40% | 97.40% | 0.00% | 0.20% | NA |
| Aus | 269 | 68.00% | 32.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 50.90% | 1.20% | 0.67% | 47.23% | NA |
| Indica II | 465 | 67.50% | 4.70% | 0.43% | 27.31% | NA |
| Indica III | 913 | 95.90% | 1.20% | 0.11% | 2.74% | NA |
| Indica Intermediate | 786 | 74.60% | 5.60% | 0.25% | 19.59% | NA |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.00% | 94.60% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 1.70% | 97.90% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 56.70% | 0.00% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0115947503 | T -> G | LOC_Os01g28474.1 | upstream_gene_variant ; 1273.0bp to feature; MODIFIER | silent_mutation | Average:35.554; most accessible tissue: Zhenshan97 young leaf, score: 45.96 | N | N | N | N |
| vg0115947503 | T -> G | LOC_Os01g28450-LOC_Os01g28474 | intergenic_region ; MODIFIER | silent_mutation | Average:35.554; most accessible tissue: Zhenshan97 young leaf, score: 45.96 | N | N | N | N |
| vg0115947503 | T -> DEL | N | N | silent_mutation | Average:35.554; most accessible tissue: Zhenshan97 young leaf, score: 45.96 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0115947503 | NA | 6.54E-10 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115947503 | 7.87E-07 | NA | mr1923 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115947503 | 8.93E-07 | 6.84E-07 | mr1923 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115947503 | NA | 1.87E-17 | mr1342_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115947503 | NA | 2.28E-08 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115947503 | NA | 1.50E-12 | mr1770_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115947503 | NA | 2.73E-08 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |