Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115947503:

Variant ID: vg0115947503 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 15947503
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, G: 0.04, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:

GGAAATTTTTGGCTCTCAAAAATTGGAGAAGTTAACCTCTAACTATTTTGACAAGAAATTTTAAGTCCTAGAATTTCGGGTACGTTACAATATGATTTGA[T/G]
TGTCATGATTATTTGAAATACTTATCAGAAATTATGGTATGGTATTCCCAAATAAAGTACTGTAGAGATAAAAGGGAGACGTGGGGGTGCCTACATGCCT

Reverse complement sequence

AGGCATGTAGGCACCCCCACGTCTCCCTTTTATCTCTACAGTACTTTATTTGGGAATACCATACCATAATTTCTGATAAGTATTTCAAATAATCATGACA[A/C]
TCAAATCATATTGTAACGTACCCGAAATTCTAGGACTTAAAATTTCTTGTCAAAATAGTTAGAGGTTAACTTCTCCAATTTTTGAGAGCCAAAAATTTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.40%	37.70%	0.19%	12.67%	NA
All Indica	2759	75.40%	3.00%	0.33%	21.28%	NA
All Japonica	1512	2.40%	97.40%	0.00%	0.20%	NA
Aus	269	68.00%	32.00%	0.00%	0.00%	NA
Indica I	595	50.90%	1.20%	0.67%	47.23%	NA
Indica II	465	67.50%	4.70%	0.43%	27.31%	NA
Indica III	913	95.90%	1.20%	0.11%	2.74%	NA
Indica Intermediate	786	74.60%	5.60%	0.25%	19.59%	NA
Temperate Japonica	767	1.00%	99.00%	0.00%	0.00%	NA
Tropical Japonica	504	5.00%	94.60%	0.00%	0.40%	NA
Japonica Intermediate	241	1.70%	97.90%	0.00%	0.41%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	33.30%	56.70%	0.00%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0115947503	T -> G	LOC_Os01g28474.1	upstream_gene_variant ; 1273.0bp to feature; MODIFIER	silent_mutation	Average:35.554; most accessible tissue: Zhenshan97 young leaf, score: 45.96	N	N	N	N
vg0115947503	T -> G	LOC_Os01g28450-LOC_Os01g28474	intergenic_region ; MODIFIER	silent_mutation	Average:35.554; most accessible tissue: Zhenshan97 young leaf, score: 45.96	N	N	N	N
vg0115947503	T -> DEL	N	N	silent_mutation	Average:35.554; most accessible tissue: Zhenshan97 young leaf, score: 45.96	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0115947503	NA	6.54E-10	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115947503	7.87E-07	NA	mr1923	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115947503	8.93E-07	6.84E-07	mr1923	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115947503	NA	1.87E-17	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115947503	NA	2.28E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115947503	NA	1.50E-12	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115947503	NA	2.73E-08	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251