\
| Variant ID: vg0115927407 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 15927407 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 90. )
TCAAATAGTCATATATGCGTAGTCTAACTGTCGTATATTAGAACCCTACACAATCTTATATGCTAAGTCTTGTTACAAATCTAATAATCTTATATTAAAA[C/T]
TAAGTCTAAGTGTCATATATTAAATCTAATAGTCTTAATTGCATTACAAATATAACAATAATATATATAATTACGTCACTTGCCTGCGCGAATTCCTTCG
CGAAGGAATTCGCGCAGGCAAGTGACGTAATTATATATATTATTGTTATATTTGTAATGCAATTAAGACTATTAGATTTAATATATGACACTTAGACTTA[G/A]
TTTTAATATAAGATTATTAGATTTGTAACAAGACTTAGCATATAAGATTGTGTAGGGTTCTAATATACGACAGTTAGACTACGCATATATGACTATTTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.70% | 0.40% | 6.43% | 31.53% | NA |
| All Indica | 2759 | 41.20% | 0.60% | 9.50% | 48.68% | NA |
| All Japonica | 1512 | 97.50% | 0.00% | 0.00% | 2.51% | NA |
| Aus | 269 | 55.00% | 0.70% | 14.13% | 30.11% | NA |
| Indica I | 595 | 28.40% | 0.80% | 4.54% | 66.22% | NA |
| Indica II | 465 | 42.60% | 0.20% | 8.39% | 48.82% | NA |
| Indica III | 913 | 46.70% | 0.90% | 13.14% | 39.32% | NA |
| Indica Intermediate | 786 | 43.90% | 0.30% | 9.67% | 46.18% | NA |
| Temperate Japonica | 767 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Tropical Japonica | 504 | 94.60% | 0.00% | 0.00% | 5.36% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 68.90% | 0.00% | 4.44% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0115927407 | C -> T | LOC_Os01g28420.1 | upstream_gene_variant ; 836.0bp to feature; MODIFIER | silent_mutation | Average:15.25; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0115927407 | C -> T | LOC_Os01g28440.1 | downstream_gene_variant ; 1856.0bp to feature; MODIFIER | silent_mutation | Average:15.25; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0115927407 | C -> T | LOC_Os01g28420-LOC_Os01g28440 | intergenic_region ; MODIFIER | silent_mutation | Average:15.25; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0115927407 | C -> DEL | N | N | silent_mutation | Average:15.25; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0115927407 | NA | 6.16E-06 | mr1419_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115927407 | 1.45E-06 | 1.45E-06 | mr1727_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |