Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115920715:

Variant ID: vg0115920715 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 15920715
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTGGTTGAACAGGAGAGATAAATGCAGTGAAAGATTAAAAATACCCCTGAGCCCACTTGTCATATTCTTCTTCCTCCTCAATTCCCCTTTTCTCCCA[T/G]
ATCCACGCTGCCGCCGCCAACGGCGTCCTAACCACGGGATTCCGTAACGACGACCGTGCTAGGCTGGTGATGTTAGAGTCGACAGGATGTGCGGCATCTT

Reverse complement sequence

AAGATGCCGCACATCCTGTCGACTCTAACATCACCAGCCTAGCACGGTCGTCGTTACGGAATCCCGTGGTTAGGACGCCGTTGGCGGCGGCAGCGTGGAT[A/C]
TGGGAGAAAAGGGGAATTGAGGAGGAAGAAGAATATGACAAGTGGGCTCAGGGGTATTTTTAATCTTTCACTGCATTTATCTCTCCTGTTCAACCAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.80%	14.70%	1.52%	0.00%	NA
All Indica	2759	99.40%	0.40%	0.14%	0.00%	NA
All Japonica	1512	51.80%	44.00%	4.23%	0.00%	NA
Aus	269	98.50%	1.10%	0.37%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.30%	1.30%	0.43%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.50%	0.25%	0.00%	NA
Temperate Japonica	767	19.70%	74.40%	5.87%	0.00%	NA
Tropical Japonica	504	94.00%	3.80%	2.18%	0.00%	NA
Japonica Intermediate	241	65.60%	31.10%	3.32%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	82.20%	15.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0115920715	T -> G	LOC_Os01g28410.1	upstream_gene_variant ; 107.0bp to feature; MODIFIER	silent_mutation	Average:62.958; most accessible tissue: Zhenshan97 young leaf, score: 82.31	N	N	N	N
vg0115920715	T -> G	LOC_Os01g28400.1	downstream_gene_variant ; 830.0bp to feature; MODIFIER	silent_mutation	Average:62.958; most accessible tissue: Zhenshan97 young leaf, score: 82.31	N	N	N	N
vg0115920715	T -> G	LOC_Os01g28420.1	downstream_gene_variant ; 2388.0bp to feature; MODIFIER	silent_mutation	Average:62.958; most accessible tissue: Zhenshan97 young leaf, score: 82.31	N	N	N	N
vg0115920715	T -> G	LOC_Os01g28400-LOC_Os01g28410	intergenic_region ; MODIFIER	silent_mutation	Average:62.958; most accessible tissue: Zhenshan97 young leaf, score: 82.31	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0115920715	NA	1.97E-12	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0115920715	NA	1.87E-06	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115920715	NA	1.54E-12	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115920715	NA	5.53E-07	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115920715	NA	1.52E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115920715	NA	2.16E-06	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115920715	NA	3.95E-06	mr1205	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115920715	NA	1.82E-10	mr1252	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115920715	NA	5.53E-08	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115920715	NA	7.53E-08	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115920715	NA	4.70E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115920715	NA	8.71E-07	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115920715	NA	5.47E-06	mr1555	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115920715	2.98E-06	3.89E-09	mr1576	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115920715	NA	9.77E-06	mr1576	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115920715	NA	2.86E-09	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115920715	NA	5.14E-07	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115920715	NA	5.26E-07	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115920715	NA	9.13E-06	mr1826	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115920715	NA	3.48E-07	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115920715	NA	4.99E-20	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115920715	NA	6.75E-09	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115920715	NA	4.57E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115920715	NA	7.41E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251