Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115915963:

Variant ID: vg0115915963 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 15915963
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACTATCTAAACGTGGTTATTTGCTGCTAGACACCTCGCGCGTTAAAATATTAATTTCCAGTTGAGTAGGAGAGATAAAGAGCGTGAAAAGTCAAAAATA[T/C]
CCCTTGCCCCACTTGTCATATTCTTCCTCTTCCTCCTTATTTCCCCTTTCTAATGTCACGGCAGCGCTCCACCGCGTCGTGGGTGCACTCTGGCACGGCG

Reverse complement sequence

CGCCGTGCCAGAGTGCACCCACGACGCGGTGGAGCGCTGCCGTGACATTAGAAAGGGGAAATAAGGAGGAAGAGGAAGAATATGACAAGTGGGGCAAGGG[A/G]
TATTTTTGACTTTTCACGCTCTTTATCTCTCCTACTCAACTGGAAATTAATATTTTAACGCGCGAGGTGTCTAGCAGCAAATAACCACGTTTAGATAGTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.80%	12.40%	3.15%	44.67%	NA
All Indica	2759	28.20%	0.70%	2.61%	68.50%	NA
All Japonica	1512	56.70%	36.60%	4.37%	2.25%	NA
Aus	269	37.90%	1.10%	2.60%	58.36%	NA
Indica I	595	50.10%	0.20%	1.68%	48.07%	NA
Indica II	465	43.20%	1.50%	3.23%	52.04%	NA
Indica III	913	4.80%	0.40%	2.74%	92.00%	NA
Indica Intermediate	786	30.00%	0.80%	2.80%	66.41%	NA
Temperate Japonica	767	32.60%	60.00%	6.65%	0.78%	NA
Tropical Japonica	504	89.70%	4.20%	1.39%	4.76%	NA
Japonica Intermediate	241	64.70%	30.30%	3.32%	1.66%	NA
VI/Aromatic	96	92.70%	0.00%	1.04%	6.25%	NA
Intermediate	90	60.00%	10.00%	3.33%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0115915963	T -> DEL	N	N	silent_mutation	Average:11.682; most accessible tissue: Callus, score: 55.217	N	N	N	N
vg0115915963	T -> C	LOC_Os01g28390.1	upstream_gene_variant ; 822.0bp to feature; MODIFIER	silent_mutation	Average:11.682; most accessible tissue: Callus, score: 55.217	N	N	N	N
vg0115915963	T -> C	LOC_Os01g28400.1	upstream_gene_variant ; 1726.0bp to feature; MODIFIER	silent_mutation	Average:11.682; most accessible tissue: Callus, score: 55.217	N	N	N	N
vg0115915963	T -> C	LOC_Os01g28410.1	upstream_gene_variant ; 4859.0bp to feature; MODIFIER	silent_mutation	Average:11.682; most accessible tissue: Callus, score: 55.217	N	N	N	N
vg0115915963	T -> C	LOC_Os01g28390-LOC_Os01g28400	intergenic_region ; MODIFIER	silent_mutation	Average:11.682; most accessible tissue: Callus, score: 55.217	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0115915963	NA	2.49E-06	mr1006	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963	7.08E-06	5.47E-07	mr1051	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963	NA	5.85E-06	mr1052	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963	NA	4.22E-06	mr1069	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963	1.15E-06	NA	mr1164	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963	NA	3.52E-07	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963	NA	1.85E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963	NA	1.12E-06	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963	NA	3.37E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963	NA	1.94E-09	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963	NA	1.10E-06	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963	7.47E-06	7.47E-06	mr1412	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963	NA	7.66E-08	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963	NA	3.93E-06	mr1555	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963	NA	3.81E-07	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963	NA	2.23E-06	mr1576	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963	NA	2.10E-08	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963	NA	2.90E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251