\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115915963:

Variant ID: vg0115915963 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 15915963
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACTATCTAAACGTGGTTATTTGCTGCTAGACACCTCGCGCGTTAAAATATTAATTTCCAGTTGAGTAGGAGAGATAAAGAGCGTGAAAAGTCAAAAATA[T/C]
CCCTTGCCCCACTTGTCATATTCTTCCTCTTCCTCCTTATTTCCCCTTTCTAATGTCACGGCAGCGCTCCACCGCGTCGTGGGTGCACTCTGGCACGGCG

Reverse complement sequence

CGCCGTGCCAGAGTGCACCCACGACGCGGTGGAGCGCTGCCGTGACATTAGAAAGGGGAAATAAGGAGGAAGAGGAAGAATATGACAAGTGGGGCAAGGG[A/G]
TATTTTTGACTTTTCACGCTCTTTATCTCTCCTACTCAACTGGAAATTAATATTTTAACGCGCGAGGTGTCTAGCAGCAAATAACCACGTTTAGATAGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.80% 12.40% 3.15% 44.67% NA
All Indica  2759 28.20% 0.70% 2.61% 68.50% NA
All Japonica  1512 56.70% 36.60% 4.37% 2.25% NA
Aus  269 37.90% 1.10% 2.60% 58.36% NA
Indica I  595 50.10% 0.20% 1.68% 48.07% NA
Indica II  465 43.20% 1.50% 3.23% 52.04% NA
Indica III  913 4.80% 0.40% 2.74% 92.00% NA
Indica Intermediate  786 30.00% 0.80% 2.80% 66.41% NA
Temperate Japonica  767 32.60% 60.00% 6.65% 0.78% NA
Tropical Japonica  504 89.70% 4.20% 1.39% 4.76% NA
Japonica Intermediate  241 64.70% 30.30% 3.32% 1.66% NA
VI/Aromatic  96 92.70% 0.00% 1.04% 6.25% NA
Intermediate  90 60.00% 10.00% 3.33% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0115915963 T -> DEL N N silent_mutation Average:11.682; most accessible tissue: Callus, score: 55.217 N N N N
vg0115915963 T -> C LOC_Os01g28390.1 upstream_gene_variant ; 822.0bp to feature; MODIFIER silent_mutation Average:11.682; most accessible tissue: Callus, score: 55.217 N N N N
vg0115915963 T -> C LOC_Os01g28400.1 upstream_gene_variant ; 1726.0bp to feature; MODIFIER silent_mutation Average:11.682; most accessible tissue: Callus, score: 55.217 N N N N
vg0115915963 T -> C LOC_Os01g28410.1 upstream_gene_variant ; 4859.0bp to feature; MODIFIER silent_mutation Average:11.682; most accessible tissue: Callus, score: 55.217 N N N N
vg0115915963 T -> C LOC_Os01g28390-LOC_Os01g28400 intergenic_region ; MODIFIER silent_mutation Average:11.682; most accessible tissue: Callus, score: 55.217 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0115915963 NA 2.49E-06 mr1006 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963 7.08E-06 5.47E-07 mr1051 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963 NA 5.85E-06 mr1052 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963 NA 4.22E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963 1.15E-06 NA mr1164 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963 NA 3.52E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963 NA 1.85E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963 NA 1.12E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963 NA 3.37E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963 NA 1.94E-09 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963 NA 1.10E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963 7.47E-06 7.47E-06 mr1412 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963 NA 7.66E-08 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963 NA 3.93E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963 NA 3.81E-07 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963 NA 2.23E-06 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963 NA 2.10E-08 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115915963 NA 2.90E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251