Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115887532:

Variant ID: vg0115887532 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 15887532
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGTCTACATACTCAACTGATGGCAATGCAAACGTGACAGCTCATGTCAAAATATATTTATCAAAGGTTGATAAGCAGTTGTCAAAGGTAGAACACGGGA[G/A]
TTTTTTTCAAACGCGCAAGAGCCTTGCACGTAGAAGATAAAATTTTGTATAACTGTTAAACGTGGATACCAAGTATTTTTTTTTCACTAGACGAGTCATT

Reverse complement sequence

AATGACTCGTCTAGTGAAAAAAAAATACTTGGTATCCACGTTTAACAGTTATACAAAATTTTATCTTCTACGTGCAAGGCTCTTGCGCGTTTGAAAAAAA[C/T]
TCCCGTGTTCTACCTTTGACAACTGCTTATCAACCTTTGATAAATATATTTTGACATGAGCTGTCACGTTTGCATTGCCATCAGTTGAGTATGTAGACTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.70% 4.50% 0.78% 0.00% NA
All Indica  2759 99.80% 0.20% 0.04% 0.00% NA
All Japonica  1512 87.40% 10.40% 2.18% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.30% 0.13% 0.00% NA
Temperate Japonica  767 95.40% 3.50% 1.04% 0.00% NA
Tropical Japonica  504 74.60% 21.00% 4.37% 0.00% NA
Japonica Intermediate  241 88.40% 10.40% 1.24% 0.00% NA
VI/Aromatic  96 52.10% 45.80% 2.08% 0.00% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0115887532 G -> A LOC_Os01g28360.1 upstream_gene_variant ; 1849.0bp to feature; MODIFIER silent_mutation Average:86.863; most accessible tissue: Zhenshan97 root, score: 92.915 N N N N
vg0115887532 G -> A LOC_Os01g28370.1 intron_variant ; MODIFIER silent_mutation Average:86.863; most accessible tissue: Zhenshan97 root, score: 92.915 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0115887532 G A -0.14 -0.06 -0.04 -0.04 -0.05 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0115887532 NA 2.85E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887532 NA 6.48E-06 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887532 NA 1.85E-09 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887532 2.42E-06 1.12E-08 mr1299_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887532 3.05E-06 1.33E-08 mr1700_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887532 4.64E-06 3.53E-08 mr1727_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887532 NA 6.48E-06 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887532 NA 3.14E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887532 NA 3.42E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887532 8.16E-06 NA mr1890_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251