\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115887270:

Variant ID: vg0115887270 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 15887270
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, G: 0.07, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTTCTGAGTGCCCTGGAACAAATTTTACCATAATCTTAACTTAATTAAAGGATTCATATTTTTTTCAATCGTCACCTCGCTTTCCGATGATTTTCGTC[G/C]
GTCGTCGTCCGCGTCCGATTTGTGAACCTGGAAAATGAATCGATAAGATTAATTGAAATCGATCTGGTGCGGTAATTGTCATCCTGTAGCAAAGTAATCG

Reverse complement sequence

CGATTACTTTGCTACAGGATGACAATTACCGCACCAGATCGATTTCAATTAATCTTATCGATTCATTTTCCAGGTTCACAAATCGGACGCGGACGACGAC[C/G]
GACGAAAATCATCGGAAAGCGAGGTGACGATTGAAAAAAATATGAATCCTTTAATTAAGTTAAGATTATGGTAAAATTTGTTCCAGGGCACTCAGAAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.40% 31.80% 0.83% 0.00% NA
All Indica  2759 97.80% 1.80% 0.43% 0.00% NA
All Japonica  1512 15.90% 82.50% 1.59% 0.00% NA
Aus  269 68.00% 31.60% 0.37% 0.00% NA
Indica I  595 99.00% 0.50% 0.50% 0.00% NA
Indica II  465 97.20% 2.60% 0.22% 0.00% NA
Indica III  913 99.10% 0.50% 0.33% 0.00% NA
Indica Intermediate  786 95.50% 3.80% 0.64% 0.00% NA
Temperate Japonica  767 1.40% 97.70% 0.91% 0.00% NA
Tropical Japonica  504 39.30% 57.70% 2.98% 0.00% NA
Japonica Intermediate  241 12.90% 86.30% 0.83% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 56.70% 41.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0115887270 G -> C LOC_Os01g28360.1 upstream_gene_variant ; 1587.0bp to feature; MODIFIER silent_mutation Average:86.869; most accessible tissue: Zhenshan97 root, score: 93.007 N N N N
vg0115887270 G -> C LOC_Os01g28370.1 intron_variant ; MODIFIER silent_mutation Average:86.869; most accessible tissue: Zhenshan97 root, score: 93.007 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0115887270 G C -0.06 -0.03 -0.02 -0.01 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0115887270 NA 6.76E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887270 NA 3.75E-08 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887270 NA 4.98E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887270 NA 6.76E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887270 NA 4.09E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887270 NA 1.92E-12 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887270 NA 3.28E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887270 NA 1.10E-14 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887270 NA 4.30E-08 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887270 NA 3.55E-13 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887270 NA 1.98E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887270 NA 2.11E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887270 NA 6.12E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887270 NA 2.90E-07 mr1840_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887270 NA 6.81E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115887270 NA 2.00E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251