Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115669420:

Variant ID: vg0115669420 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 15669420
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, C: 0.29, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

TATCAGTATCGGGGAAGAAGATTAGATCGAAGCAGAATCAAAGATGAGGATCGTCGTGGAAACAGAGTAAGAATCGGCTGGAGTTCGAATCGGCTACGAT[T/C]
GGGATCGGCTAAGTCCGAGTCAGACTGGGTTAGGTGATACAGCCAATTCCGACAATACGACTTGGTGTACGACATCGGGTCGAGTTGATATGCTTGAAGA

Reverse complement sequence

TCTTCAAGCATATCAACTCGACCCGATGTCGTACACCAAGTCGTATTGTCGGAATTGGCTGTATCACCTAACCCAGTCTGACTCGGACTTAGCCGATCCC[A/G]
ATCGTAGCCGATTCGAACTCCAGCCGATTCTTACTCTGTTTCCACGACGATCCTCATCTTTGATTCTGCTTCGATCTAATCTTCTTCCCCGATACTGATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.80%	39.00%	0.23%	0.00%	NA
All Indica	2759	94.50%	5.10%	0.40%	0.00%	NA
All Japonica	1512	2.60%	97.40%	0.00%	0.00%	NA
Aus	269	68.00%	32.00%	0.00%	0.00%	NA
Indica I	595	98.20%	0.80%	1.01%	0.00%	NA
Indica II	465	84.90%	14.80%	0.22%	0.00%	NA
Indica III	913	98.90%	1.00%	0.11%	0.00%	NA
Indica Intermediate	786	92.20%	7.40%	0.38%	0.00%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	5.40%	94.60%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	42.20%	57.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0115669420	T -> C	LOC_Os01g28020.1	upstream_gene_variant ; 362.0bp to feature; MODIFIER	silent_mutation	Average:34.122; most accessible tissue: Zhenshan97 flag leaf, score: 47.303	N	N	N	N
vg0115669420	T -> C	LOC_Os01g28030.1	downstream_gene_variant ; 3146.0bp to feature; MODIFIER	silent_mutation	Average:34.122; most accessible tissue: Zhenshan97 flag leaf, score: 47.303	N	N	N	N
vg0115669420	T -> C	LOC_Os01g28020-LOC_Os01g28030	intergenic_region ; MODIFIER	silent_mutation	Average:34.122; most accessible tissue: Zhenshan97 flag leaf, score: 47.303	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0115669420	NA	1.22E-08	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115669420	NA	5.07E-07	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115669420	NA	2.01E-19	mr1040_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115669420	NA	1.17E-22	mr1362_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115669420	NA	5.09E-44	mr1519_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115669420	NA	7.45E-07	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115669420	NA	2.04E-19	mr1581_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115669420	NA	3.54E-14	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115669420	NA	1.23E-18	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115669420	NA	4.32E-09	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115669420	NA	4.32E-09	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251