\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115643513:

Variant ID: vg0115643513 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 15643513
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, C: 0.33, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


AAACTTATTAAAGTGAGTCATTTCAGTCTTAAATTGCCATGACCCTTCGAGTATCCTACATGGCATGCCACATAGTCACTAAAGCGATATGCCACACTGA[T/C]
ATTCCAGTCCCAATTTTTCTTTTTTTCCTTCCCCTCTGTGTTGTCCTTATCTTATTTTGTCTTTTTTTTTTCACACGAACATGAAGGAAGAAGAGAAGAA

Reverse complement sequence

TTCTTCTCTTCTTCCTTCATGTTCGTGTGAAAAAAAAAAGACAAAATAAGATAAGGACAACACAGAGGGGAAGGAAAAAAAGAAAAATTGGGACTGGAAT[A/G]
TCAGTGTGGCATATCGCTTTAGTGACTATGTGGCATGCCATGTAGGATACTCGAAGGGTCATGGCAATTTAAGACTGAAATGACTCACTTTAATAAGTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.70% 38.10% 0.15% 0.00% NA
All Indica  2759 96.20% 3.60% 0.25% 0.00% NA
All Japonica  1512 2.50% 97.50% 0.00% 0.00% NA
Aus  269 67.70% 32.30% 0.00% 0.00% NA
Indica I  595 96.10% 3.00% 0.84% 0.00% NA
Indica II  465 95.10% 4.50% 0.43% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 93.50% 6.50% 0.00% 0.00% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 5.20% 94.80% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 42.20% 57.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0115643513 T -> C LOC_Os01g27980.1 upstream_gene_variant ; 2875.0bp to feature; MODIFIER silent_mutation Average:23.483; most accessible tissue: Callus, score: 59.35 N N N N
vg0115643513 T -> C LOC_Os01g27990.1 upstream_gene_variant ; 1299.0bp to feature; MODIFIER silent_mutation Average:23.483; most accessible tissue: Callus, score: 59.35 N N N N
vg0115643513 T -> C LOC_Os01g27990.2 upstream_gene_variant ; 1299.0bp to feature; MODIFIER silent_mutation Average:23.483; most accessible tissue: Callus, score: 59.35 N N N N
vg0115643513 T -> C LOC_Os01g27980-LOC_Os01g27990 intergenic_region ; MODIFIER silent_mutation Average:23.483; most accessible tissue: Callus, score: 59.35 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0115643513 NA 4.59E-08 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643513 NA 5.57E-13 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643513 NA 7.06E-47 mr1519 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643513 NA 8.97E-18 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643513 NA 4.80E-70 mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643513 NA 1.83E-55 mr1200_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643513 NA 1.64E-54 mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643513 NA 9.67E-22 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643513 NA 7.02E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643513 NA 5.52E-10 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643513 NA 1.93E-48 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643513 NA 7.46E-57 mr1526_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643513 NA 2.64E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643513 NA 1.06E-21 mr1581_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643513 NA 3.04E-22 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643513 NA 2.96E-23 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643513 NA 1.37E-12 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643513 NA 8.84E-15 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643513 NA 4.49E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643513 NA 6.15E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643513 NA 1.12E-17 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643513 NA 5.05E-32 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643513 NA 3.54E-25 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115643513 NA 2.68E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251