\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115542560:

Variant ID: vg0115542560 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 15542560
Reference Allele: GAlternative Allele: C,T
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


TGGAACTTTCTTTTAGTCTCTAGATGTAAAAGATTTCAATAGGAATTAATTCGTTGGCAGTTTGTGCAATTTCTGAGATTATTGGTTATGGGCTGGAAAC[G/C,T]
GTATTTTCAAAACTGACATTAAACCTTCACGATTCAGGTTAGTTGTCCTAAATAAAGTTTGTAGTCATCGACGATATCTTTCTAACGCCGCTGGTTTCGC

Reverse complement sequence

GCGAAACCAGCGGCGTTAGAAAGATATCGTCGATGACTACAAACTTTATTTAGGACAACTAACCTGAATCGTGAAGGTTTAATGTCAGTTTTGAAAATAC[C/G,A]
GTTTCCAGCCCATAACCAATAATCTCAGAAATTGCACAAACTGCCAACGAATTAATTCCTATTGAAATCTTTTACATCTAGAGACTAAAAGAAAGTTCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.30% 9.70% 2.56% 0.32% T: 0.11%
All Indica  2759 99.40% 0.20% 0.14% 0.18% T: 0.07%
All Japonica  1512 63.60% 29.40% 6.61% 0.33% NA
Aus  269 91.10% 0.40% 5.95% 1.86% T: 0.74%
Indica I  595 99.80% 0.00% 0.00% 0.17% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 98.60% 0.30% 0.38% 0.51% T: 0.25%
Temperate Japonica  767 38.50% 49.50% 11.34% 0.65% NA
Tropical Japonica  504 98.00% 1.20% 0.79% 0.00% NA
Japonica Intermediate  241 71.80% 24.50% 3.73% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 8.90% 1.11% 0.00% T: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0115542560 G -> T LOC_Os01g27834.1 downstream_gene_variant ; 2023.0bp to feature; MODIFIER silent_mutation Average:73.754; most accessible tissue: Zhenshan97 flower, score: 85.053 N N N N
vg0115542560 G -> T LOC_Os01g27834-LOC_Os01g27850 intergenic_region ; MODIFIER silent_mutation Average:73.754; most accessible tissue: Zhenshan97 flower, score: 85.053 N N N N
vg0115542560 G -> DEL N N silent_mutation Average:73.754; most accessible tissue: Zhenshan97 flower, score: 85.053 N N N N
vg0115542560 G -> C LOC_Os01g27834.1 downstream_gene_variant ; 2023.0bp to feature; MODIFIER silent_mutation Average:73.754; most accessible tissue: Zhenshan97 flower, score: 85.053 N N N N
vg0115542560 G -> C LOC_Os01g27834-LOC_Os01g27850 intergenic_region ; MODIFIER silent_mutation Average:73.754; most accessible tissue: Zhenshan97 flower, score: 85.053 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0115542560 NA 4.99E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0115542560 NA 9.31E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0115542560 NA 9.14E-06 mr1006 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560 NA 5.22E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560 NA 4.04E-06 mr1075 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560 NA 4.92E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560 NA 4.79E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560 NA 8.18E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560 4.90E-06 2.88E-09 mr1202 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560 NA 6.66E-09 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560 NA 5.10E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560 NA 4.18E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560 NA 1.20E-07 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560 NA 1.03E-07 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560 NA 2.54E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560 NA 3.52E-06 mr1654 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560 6.02E-06 NA mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560 NA 1.00E-07 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251