\
| Variant ID: vg0115542560 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 15542560 |
| Reference Allele: G | Alternative Allele: C,T |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 309. )
TGGAACTTTCTTTTAGTCTCTAGATGTAAAAGATTTCAATAGGAATTAATTCGTTGGCAGTTTGTGCAATTTCTGAGATTATTGGTTATGGGCTGGAAAC[G/C,T]
GTATTTTCAAAACTGACATTAAACCTTCACGATTCAGGTTAGTTGTCCTAAATAAAGTTTGTAGTCATCGACGATATCTTTCTAACGCCGCTGGTTTCGC
GCGAAACCAGCGGCGTTAGAAAGATATCGTCGATGACTACAAACTTTATTTAGGACAACTAACCTGAATCGTGAAGGTTTAATGTCAGTTTTGAAAATAC[C/G,A]
GTTTCCAGCCCATAACCAATAATCTCAGAAATTGCACAAACTGCCAACGAATTAATTCCTATTGAAATCTTTTACATCTAGAGACTAAAAGAAAGTTCCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.30% | 9.70% | 2.56% | 0.32% | T: 0.11% |
| All Indica | 2759 | 99.40% | 0.20% | 0.14% | 0.18% | T: 0.07% |
| All Japonica | 1512 | 63.60% | 29.40% | 6.61% | 0.33% | NA |
| Aus | 269 | 91.10% | 0.40% | 5.95% | 1.86% | T: 0.74% |
| Indica I | 595 | 99.80% | 0.00% | 0.00% | 0.17% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 0.30% | 0.38% | 0.51% | T: 0.25% |
| Temperate Japonica | 767 | 38.50% | 49.50% | 11.34% | 0.65% | NA |
| Tropical Japonica | 504 | 98.00% | 1.20% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.80% | 24.50% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 8.90% | 1.11% | 0.00% | T: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0115542560 | G -> T | LOC_Os01g27834.1 | downstream_gene_variant ; 2023.0bp to feature; MODIFIER | silent_mutation | Average:73.754; most accessible tissue: Zhenshan97 flower, score: 85.053 | N | N | N | N |
| vg0115542560 | G -> T | LOC_Os01g27834-LOC_Os01g27850 | intergenic_region ; MODIFIER | silent_mutation | Average:73.754; most accessible tissue: Zhenshan97 flower, score: 85.053 | N | N | N | N |
| vg0115542560 | G -> DEL | N | N | silent_mutation | Average:73.754; most accessible tissue: Zhenshan97 flower, score: 85.053 | N | N | N | N |
| vg0115542560 | G -> C | LOC_Os01g27834.1 | downstream_gene_variant ; 2023.0bp to feature; MODIFIER | silent_mutation | Average:73.754; most accessible tissue: Zhenshan97 flower, score: 85.053 | N | N | N | N |
| vg0115542560 | G -> C | LOC_Os01g27834-LOC_Os01g27850 | intergenic_region ; MODIFIER | silent_mutation | Average:73.754; most accessible tissue: Zhenshan97 flower, score: 85.053 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0115542560 | NA | 4.99E-10 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0115542560 | NA | 9.31E-14 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0115542560 | NA | 9.14E-06 | mr1006 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115542560 | NA | 5.22E-06 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115542560 | NA | 4.04E-06 | mr1075 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115542560 | NA | 4.92E-06 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115542560 | NA | 4.79E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115542560 | NA | 8.18E-07 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115542560 | 4.90E-06 | 2.88E-09 | mr1202 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115542560 | NA | 6.66E-09 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115542560 | NA | 5.10E-07 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115542560 | NA | 4.18E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115542560 | NA | 1.20E-07 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115542560 | NA | 1.03E-07 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115542560 | NA | 2.54E-06 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115542560 | NA | 3.52E-06 | mr1654 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115542560 | 6.02E-06 | NA | mr1789 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115542560 | NA | 1.00E-07 | mr1864 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |