Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115542560:

Variant ID: vg0115542560 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 15542560
Reference Allele: G	Alternative Allele: C,T
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

TGGAACTTTCTTTTAGTCTCTAGATGTAAAAGATTTCAATAGGAATTAATTCGTTGGCAGTTTGTGCAATTTCTGAGATTATTGGTTATGGGCTGGAAAC[G/C,T]
GTATTTTCAAAACTGACATTAAACCTTCACGATTCAGGTTAGTTGTCCTAAATAAAGTTTGTAGTCATCGACGATATCTTTCTAACGCCGCTGGTTTCGC

Reverse complement sequence

GCGAAACCAGCGGCGTTAGAAAGATATCGTCGATGACTACAAACTTTATTTAGGACAACTAACCTGAATCGTGAAGGTTTAATGTCAGTTTTGAAAATAC[C/G,A]
GTTTCCAGCCCATAACCAATAATCTCAGAAATTGCACAAACTGCCAACGAATTAATTCCTATTGAAATCTTTTACATCTAGAGACTAAAAGAAAGTTCCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.30%	9.70%	2.56%	0.32%	T: 0.11%
All Indica	2759	99.40%	0.20%	0.14%	0.18%	T: 0.07%
All Japonica	1512	63.60%	29.40%	6.61%	0.33%	NA
Aus	269	91.10%	0.40%	5.95%	1.86%	T: 0.74%
Indica I	595	99.80%	0.00%	0.00%	0.17%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	98.60%	0.30%	0.38%	0.51%	T: 0.25%
Temperate Japonica	767	38.50%	49.50%	11.34%	0.65%	NA
Tropical Japonica	504	98.00%	1.20%	0.79%	0.00%	NA
Japonica Intermediate	241	71.80%	24.50%	3.73%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	8.90%	1.11%	0.00%	T: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0115542560	G -> T	LOC_Os01g27834.1	downstream_gene_variant ; 2023.0bp to feature; MODIFIER	silent_mutation	Average:73.754; most accessible tissue: Zhenshan97 flower, score: 85.053	N	N	N	N
vg0115542560	G -> T	LOC_Os01g27834-LOC_Os01g27850	intergenic_region ; MODIFIER	silent_mutation	Average:73.754; most accessible tissue: Zhenshan97 flower, score: 85.053	N	N	N	N
vg0115542560	G -> DEL	N	N	silent_mutation	Average:73.754; most accessible tissue: Zhenshan97 flower, score: 85.053	N	N	N	N
vg0115542560	G -> C	LOC_Os01g27834.1	downstream_gene_variant ; 2023.0bp to feature; MODIFIER	silent_mutation	Average:73.754; most accessible tissue: Zhenshan97 flower, score: 85.053	N	N	N	N
vg0115542560	G -> C	LOC_Os01g27834-LOC_Os01g27850	intergenic_region ; MODIFIER	silent_mutation	Average:73.754; most accessible tissue: Zhenshan97 flower, score: 85.053	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0115542560	NA	4.99E-10	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0115542560	NA	9.31E-14	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0115542560	NA	9.14E-06	mr1006	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560	NA	5.22E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560	NA	4.04E-06	mr1075	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560	NA	4.92E-06	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560	NA	4.79E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560	NA	8.18E-07	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560	4.90E-06	2.88E-09	mr1202	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560	NA	6.66E-09	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560	NA	5.10E-07	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560	NA	4.18E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560	NA	1.20E-07	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560	NA	1.03E-07	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560	NA	2.54E-06	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560	NA	3.52E-06	mr1654	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560	6.02E-06	NA	mr1789	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115542560	NA	1.00E-07	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251