\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115532707:

Variant ID: vg0115532707 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 15532707
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ACCTCCATCTCTATTTATACCAAGAACCTTCAACTTCAACTTAAAGGACGTGTAAAACTCCATTTCACGATATTACTCAATCCATCATATTTCTTTTTCT[C/T]
CAAAACCGCAGCCGGACTTCCATTCGGACTCCTGCGAGTCCTCGCGTGGGCCGGCTCGGACCAGGCCGACCGCTGCTGCTCCCTAGCCGACTCGGTTTAC

Reverse complement sequence

GTAAACCGAGTCGGCTAGGGAGCAGCAGCGGTCGGCCTGGTCCGAGCCGGCCCACGCGAGGACTCGCAGGAGTCCGAATGGAAGTCCGGCTGCGGTTTTG[G/A]
AGAAAAAGAAATATGATGGATTGAGTAATATCGTGAAATGGAGTTTTACACGTCCTTTAAGTTGAAGTTGAAGGTTCTTGGTATAAATAGAGATGGAGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.80% 19.00% 0.08% 0.13% NA
All Indica  2759 70.50% 29.10% 0.14% 0.22% NA
All Japonica  1512 97.70% 2.30% 0.00% 0.00% NA
Aus  269 80.30% 19.70% 0.00% 0.00% NA
Indica I  595 62.20% 37.80% 0.00% 0.00% NA
Indica II  465 95.30% 4.50% 0.22% 0.00% NA
Indica III  913 59.40% 40.10% 0.22% 0.33% NA
Indica Intermediate  786 75.10% 24.40% 0.13% 0.38% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 95.00% 5.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0115532707 C -> T LOC_Os01g27820.1 downstream_gene_variant ; 1494.0bp to feature; MODIFIER silent_mutation Average:90.562; most accessible tissue: Zhenshan97 panicle, score: 95.602 N N N N
vg0115532707 C -> T LOC_Os01g27800-LOC_Os01g27820 intergenic_region ; MODIFIER silent_mutation Average:90.562; most accessible tissue: Zhenshan97 panicle, score: 95.602 N N N N
vg0115532707 C -> DEL N N silent_mutation Average:90.562; most accessible tissue: Zhenshan97 panicle, score: 95.602 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0115532707 C T 0.04 0.03 0.02 0.03 0.03 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0115532707 NA 6.37E-07 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115532707 NA 1.32E-07 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115532707 NA 1.30E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115532707 NA 2.83E-06 mr1105_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115532707 NA 2.58E-07 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115532707 2.63E-08 NA mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115532707 5.48E-07 3.20E-14 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115532707 NA 1.02E-07 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115532707 NA 3.12E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115532707 NA 8.18E-07 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115532707 NA 3.15E-06 mr1901_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115532707 2.62E-06 2.61E-06 mr1953_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251