\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115495344:

Variant ID: vg0115495344 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 15495344
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


CATATAAATATTATATGTACGTATATGCAATTTTGCTGTATATTTATCAACAAATTTTCTCCTAAAAATTTGACGGATGTAATTACAGTACAATCGTAAT[G/A]
TAACTAGTATGTAACTACAATGCAACTTGTATGTAACTTTTACATAATTTTGAACCGTTAGATTTGTTTCAAGATTTGTGCAACTAAAGAAGGAAAAATG

Reverse complement sequence

CATTTTTCCTTCTTTAGTTGCACAAATCTTGAAACAAATCTAACGGTTCAAAATTATGTAAAAGTTACATACAAGTTGCATTGTAGTTACATACTAGTTA[C/T]
ATTACGATTGTACTGTAATTACATCCGTCAAATTTTTAGGAGAAAATTTGTTGATAAATATACAGCAAAATTGCATATACGTACATATAATATTTATATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.70% 22.20% 0.17% 0.00% NA
All Indica  2759 71.90% 28.00% 0.14% 0.00% NA
All Japonica  1512 85.60% 14.10% 0.26% 0.00% NA
Aus  269 80.30% 19.70% 0.00% 0.00% NA
Indica I  595 60.00% 39.30% 0.67% 0.00% NA
Indica II  465 94.60% 5.40% 0.00% 0.00% NA
Indica III  913 64.60% 35.40% 0.00% 0.00% NA
Indica Intermediate  786 75.80% 24.20% 0.00% 0.00% NA
Temperate Japonica  767 98.70% 1.20% 0.13% 0.00% NA
Tropical Japonica  504 61.30% 38.30% 0.40% 0.00% NA
Japonica Intermediate  241 95.00% 4.60% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0115495344 G -> A LOC_Os01g27750.1 downstream_gene_variant ; 1795.0bp to feature; MODIFIER silent_mutation Average:51.557; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0115495344 G -> A LOC_Os01g27760.1 intron_variant ; MODIFIER silent_mutation Average:51.557; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0115495344 2.24E-06 1.61E-08 mr1519 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115495344 NA 1.41E-06 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115495344 NA 2.41E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115495344 4.60E-06 NA mr1105_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115495344 NA 4.04E-06 mr1105_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115495344 NA 5.15E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115495344 3.35E-07 NA mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115495344 1.27E-09 1.16E-17 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115495344 NA 1.32E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251