Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115495344:

Variant ID: vg0115495344 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 15495344
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

CATATAAATATTATATGTACGTATATGCAATTTTGCTGTATATTTATCAACAAATTTTCTCCTAAAAATTTGACGGATGTAATTACAGTACAATCGTAAT[G/A]
TAACTAGTATGTAACTACAATGCAACTTGTATGTAACTTTTACATAATTTTGAACCGTTAGATTTGTTTCAAGATTTGTGCAACTAAAGAAGGAAAAATG

Reverse complement sequence

CATTTTTCCTTCTTTAGTTGCACAAATCTTGAAACAAATCTAACGGTTCAAAATTATGTAAAAGTTACATACAAGTTGCATTGTAGTTACATACTAGTTA[C/T]
ATTACGATTGTACTGTAATTACATCCGTCAAATTTTTAGGAGAAAATTTGTTGATAAATATACAGCAAAATTGCATATACGTACATATAATATTTATATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.70%	22.20%	0.17%	0.00%	NA
All Indica	2759	71.90%	28.00%	0.14%	0.00%	NA
All Japonica	1512	85.60%	14.10%	0.26%	0.00%	NA
Aus	269	80.30%	19.70%	0.00%	0.00%	NA
Indica I	595	60.00%	39.30%	0.67%	0.00%	NA
Indica II	465	94.60%	5.40%	0.00%	0.00%	NA
Indica III	913	64.60%	35.40%	0.00%	0.00%	NA
Indica Intermediate	786	75.80%	24.20%	0.00%	0.00%	NA
Temperate Japonica	767	98.70%	1.20%	0.13%	0.00%	NA
Tropical Japonica	504	61.30%	38.30%	0.40%	0.00%	NA
Japonica Intermediate	241	95.00%	4.60%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0115495344	G -> A	LOC_Os01g27750.1	downstream_gene_variant ; 1795.0bp to feature; MODIFIER	silent_mutation	Average:51.557; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0115495344	G -> A	LOC_Os01g27760.1	intron_variant ; MODIFIER	silent_mutation	Average:51.557; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0115495344	2.24E-06	1.61E-08	mr1519	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115495344	NA	1.41E-06	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115495344	NA	2.41E-07	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115495344	4.60E-06	NA	mr1105_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115495344	NA	4.04E-06	mr1105_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115495344	NA	5.15E-06	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115495344	3.35E-07	NA	mr1519_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115495344	1.27E-09	1.16E-17	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115495344	NA	1.32E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251