\
| Variant ID: vg0115495344 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 15495344 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 126. )
CATATAAATATTATATGTACGTATATGCAATTTTGCTGTATATTTATCAACAAATTTTCTCCTAAAAATTTGACGGATGTAATTACAGTACAATCGTAAT[G/A]
TAACTAGTATGTAACTACAATGCAACTTGTATGTAACTTTTACATAATTTTGAACCGTTAGATTTGTTTCAAGATTTGTGCAACTAAAGAAGGAAAAATG
CATTTTTCCTTCTTTAGTTGCACAAATCTTGAAACAAATCTAACGGTTCAAAATTATGTAAAAGTTACATACAAGTTGCATTGTAGTTACATACTAGTTA[C/T]
ATTACGATTGTACTGTAATTACATCCGTCAAATTTTTAGGAGAAAATTTGTTGATAAATATACAGCAAAATTGCATATACGTACATATAATATTTATATG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.70% | 22.20% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 71.90% | 28.00% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 85.60% | 14.10% | 0.26% | 0.00% | NA |
| Aus | 269 | 80.30% | 19.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 60.00% | 39.30% | 0.67% | 0.00% | NA |
| Indica II | 465 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 64.60% | 35.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 75.80% | 24.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 1.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 61.30% | 38.30% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.00% | 4.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0115495344 | G -> A | LOC_Os01g27750.1 | downstream_gene_variant ; 1795.0bp to feature; MODIFIER | silent_mutation | Average:51.557; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0115495344 | G -> A | LOC_Os01g27760.1 | intron_variant ; MODIFIER | silent_mutation | Average:51.557; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0115495344 | 2.24E-06 | 1.61E-08 | mr1519 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115495344 | NA | 1.41E-06 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115495344 | NA | 2.41E-07 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115495344 | 4.60E-06 | NA | mr1105_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115495344 | NA | 4.04E-06 | mr1105_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115495344 | NA | 5.15E-06 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115495344 | 3.35E-07 | NA | mr1519_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115495344 | 1.27E-09 | 1.16E-17 | mr1519_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115495344 | NA | 1.32E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |