Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115386399:

Variant ID: vg0115386399 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 15386399
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:

CCGCCAGATCCGACGGAAGGGGAGGCGGAGGCCGCGGCCGGCGGAAGGGCGATGCGGTGGCGGCGAGCGGCAGGAGGATGGCGGTTGGAGGCCGCGAATC[G/A]
ATCTCTTCCCCTCCCCTTCTTGTCCCTCCTCCTTTGTGTTTTGTATTATTTCCTCTGTAATTTGTTGAATATGATCTAGATGTGTTCATGGATTTGATGC

Reverse complement sequence

GCATCAAATCCATGAACACATCTAGATCATATTCAACAAATTACAGAGGAAATAATACAAAACACAAAGGAGGAGGGACAAGAAGGGGAGGGGAAGAGAT[C/T]
GATTCGCGGCCTCCAACCGCCATCCTCCTGCCGCTCGCCGCCACCGCATCGCCCTTCCGCCGGCCGCGGCCTCCGCCTCCCCTTCCGTCGGATCTGGCGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.70%	12.90%	0.21%	3.13%	NA
All Indica	2759	74.70%	20.00%	0.33%	4.93%	NA
All Japonica	1512	97.70%	1.90%	0.07%	0.40%	NA
Aus	269	87.00%	10.80%	0.00%	2.23%	NA
Indica I	595	59.80%	33.40%	0.50%	6.22%	NA
Indica II	465	95.90%	3.00%	0.00%	1.08%	NA
Indica III	913	71.00%	21.90%	0.22%	6.90%	NA
Indica Intermediate	786	77.90%	17.70%	0.51%	3.94%	NA
Temperate Japonica	767	99.10%	0.70%	0.00%	0.26%	NA
Tropical Japonica	504	95.00%	4.00%	0.20%	0.79%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0115386399	G -> A	LOC_Os01g27570.1	upstream_gene_variant ; 953.0bp to feature; MODIFIER	silent_mutation	Average:45.31; most accessible tissue: Minghui63 young leaf, score: 71.254	N	N	N	N
vg0115386399	G -> A	LOC_Os01g27560.1	downstream_gene_variant ; 4389.0bp to feature; MODIFIER	silent_mutation	Average:45.31; most accessible tissue: Minghui63 young leaf, score: 71.254	N	N	N	N
vg0115386399	G -> A	LOC_Os01g27580.1	downstream_gene_variant ; 1054.0bp to feature; MODIFIER	silent_mutation	Average:45.31; most accessible tissue: Minghui63 young leaf, score: 71.254	N	N	N	N
vg0115386399	G -> A	LOC_Os01g27590.1	downstream_gene_variant ; 3333.0bp to feature; MODIFIER	silent_mutation	Average:45.31; most accessible tissue: Minghui63 young leaf, score: 71.254	N	N	N	N
vg0115386399	G -> A	LOC_Os01g27570-LOC_Os01g27580	intergenic_region ; MODIFIER	silent_mutation	Average:45.31; most accessible tissue: Minghui63 young leaf, score: 71.254	N	N	N	N
vg0115386399	G -> DEL	N	N	silent_mutation	Average:45.31; most accessible tissue: Minghui63 young leaf, score: 71.254	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0115386399	4.41E-08	NA	mr1519	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115386399	3.24E-08	2.97E-10	mr1519	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115386399	NA	5.66E-06	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115386399	NA	1.44E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115386399	NA	1.18E-06	mr1105_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115386399	NA	2.72E-07	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115386399	1.59E-13	NA	mr1519_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115386399	3.88E-15	2.72E-23	mr1519_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115386399	NA	1.42E-07	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251