\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115386399:

Variant ID: vg0115386399 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 15386399
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


CCGCCAGATCCGACGGAAGGGGAGGCGGAGGCCGCGGCCGGCGGAAGGGCGATGCGGTGGCGGCGAGCGGCAGGAGGATGGCGGTTGGAGGCCGCGAATC[G/A]
ATCTCTTCCCCTCCCCTTCTTGTCCCTCCTCCTTTGTGTTTTGTATTATTTCCTCTGTAATTTGTTGAATATGATCTAGATGTGTTCATGGATTTGATGC

Reverse complement sequence

GCATCAAATCCATGAACACATCTAGATCATATTCAACAAATTACAGAGGAAATAATACAAAACACAAAGGAGGAGGGACAAGAAGGGGAGGGGAAGAGAT[C/T]
GATTCGCGGCCTCCAACCGCCATCCTCCTGCCGCTCGCCGCCACCGCATCGCCCTTCCGCCGGCCGCGGCCTCCGCCTCCCCTTCCGTCGGATCTGGCGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.70% 12.90% 0.21% 3.13% NA
All Indica  2759 74.70% 20.00% 0.33% 4.93% NA
All Japonica  1512 97.70% 1.90% 0.07% 0.40% NA
Aus  269 87.00% 10.80% 0.00% 2.23% NA
Indica I  595 59.80% 33.40% 0.50% 6.22% NA
Indica II  465 95.90% 3.00% 0.00% 1.08% NA
Indica III  913 71.00% 21.90% 0.22% 6.90% NA
Indica Intermediate  786 77.90% 17.70% 0.51% 3.94% NA
Temperate Japonica  767 99.10% 0.70% 0.00% 0.26% NA
Tropical Japonica  504 95.00% 4.00% 0.20% 0.79% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0115386399 G -> A LOC_Os01g27570.1 upstream_gene_variant ; 953.0bp to feature; MODIFIER silent_mutation Average:45.31; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N
vg0115386399 G -> A LOC_Os01g27560.1 downstream_gene_variant ; 4389.0bp to feature; MODIFIER silent_mutation Average:45.31; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N
vg0115386399 G -> A LOC_Os01g27580.1 downstream_gene_variant ; 1054.0bp to feature; MODIFIER silent_mutation Average:45.31; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N
vg0115386399 G -> A LOC_Os01g27590.1 downstream_gene_variant ; 3333.0bp to feature; MODIFIER silent_mutation Average:45.31; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N
vg0115386399 G -> A LOC_Os01g27570-LOC_Os01g27580 intergenic_region ; MODIFIER silent_mutation Average:45.31; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N
vg0115386399 G -> DEL N N silent_mutation Average:45.31; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0115386399 4.41E-08 NA mr1519 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115386399 3.24E-08 2.97E-10 mr1519 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115386399 NA 5.66E-06 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115386399 NA 1.44E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115386399 NA 1.18E-06 mr1105_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115386399 NA 2.72E-07 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115386399 1.59E-13 NA mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115386399 3.88E-15 2.72E-23 mr1519_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115386399 NA 1.42E-07 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251