\
| Variant ID: vg0115386399 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 15386399 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 69. )
CCGCCAGATCCGACGGAAGGGGAGGCGGAGGCCGCGGCCGGCGGAAGGGCGATGCGGTGGCGGCGAGCGGCAGGAGGATGGCGGTTGGAGGCCGCGAATC[G/A]
ATCTCTTCCCCTCCCCTTCTTGTCCCTCCTCCTTTGTGTTTTGTATTATTTCCTCTGTAATTTGTTGAATATGATCTAGATGTGTTCATGGATTTGATGC
GCATCAAATCCATGAACACATCTAGATCATATTCAACAAATTACAGAGGAAATAATACAAAACACAAAGGAGGAGGGACAAGAAGGGGAGGGGAAGAGAT[C/T]
GATTCGCGGCCTCCAACCGCCATCCTCCTGCCGCTCGCCGCCACCGCATCGCCCTTCCGCCGGCCGCGGCCTCCGCCTCCCCTTCCGTCGGATCTGGCGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.70% | 12.90% | 0.21% | 3.13% | NA |
| All Indica | 2759 | 74.70% | 20.00% | 0.33% | 4.93% | NA |
| All Japonica | 1512 | 97.70% | 1.90% | 0.07% | 0.40% | NA |
| Aus | 269 | 87.00% | 10.80% | 0.00% | 2.23% | NA |
| Indica I | 595 | 59.80% | 33.40% | 0.50% | 6.22% | NA |
| Indica II | 465 | 95.90% | 3.00% | 0.00% | 1.08% | NA |
| Indica III | 913 | 71.00% | 21.90% | 0.22% | 6.90% | NA |
| Indica Intermediate | 786 | 77.90% | 17.70% | 0.51% | 3.94% | NA |
| Temperate Japonica | 767 | 99.10% | 0.70% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 95.00% | 4.00% | 0.20% | 0.79% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0115386399 | G -> A | LOC_Os01g27570.1 | upstream_gene_variant ; 953.0bp to feature; MODIFIER | silent_mutation | Average:45.31; most accessible tissue: Minghui63 young leaf, score: 71.254 | N | N | N | N |
| vg0115386399 | G -> A | LOC_Os01g27560.1 | downstream_gene_variant ; 4389.0bp to feature; MODIFIER | silent_mutation | Average:45.31; most accessible tissue: Minghui63 young leaf, score: 71.254 | N | N | N | N |
| vg0115386399 | G -> A | LOC_Os01g27580.1 | downstream_gene_variant ; 1054.0bp to feature; MODIFIER | silent_mutation | Average:45.31; most accessible tissue: Minghui63 young leaf, score: 71.254 | N | N | N | N |
| vg0115386399 | G -> A | LOC_Os01g27590.1 | downstream_gene_variant ; 3333.0bp to feature; MODIFIER | silent_mutation | Average:45.31; most accessible tissue: Minghui63 young leaf, score: 71.254 | N | N | N | N |
| vg0115386399 | G -> A | LOC_Os01g27570-LOC_Os01g27580 | intergenic_region ; MODIFIER | silent_mutation | Average:45.31; most accessible tissue: Minghui63 young leaf, score: 71.254 | N | N | N | N |
| vg0115386399 | G -> DEL | N | N | silent_mutation | Average:45.31; most accessible tissue: Minghui63 young leaf, score: 71.254 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0115386399 | 4.41E-08 | NA | mr1519 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115386399 | 3.24E-08 | 2.97E-10 | mr1519 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115386399 | NA | 5.66E-06 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115386399 | NA | 1.44E-06 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115386399 | NA | 1.18E-06 | mr1105_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115386399 | NA | 2.72E-07 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115386399 | 1.59E-13 | NA | mr1519_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115386399 | 3.88E-15 | 2.72E-23 | mr1519_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115386399 | NA | 1.42E-07 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |