\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115342747:

Variant ID: vg0115342747 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 15342747
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCATGTGAGCTACAATGTATTAATATATATAGTTGTGCATCAACAATGGATGTGTTGTTCTCCAATATACTTCGCTTAGTATATATATCGACATGCCTTG[T/C]
ATGTGCACGCTCACTAGTAGCCCTAAAAAGGCCACATGTTTGTGCTTCATCATATATCATCACATAATTATTCCTGAACATTGCGCCACTGTCTCCACAA

Reverse complement sequence

TTGTGGAGACAGTGGCGCAATGTTCAGGAATAATTATGTGATGATATATGATGAAGCACAAACATGTGGCCTTTTTAGGGCTACTAGTGAGCGTGCACAT[A/G]
CAAGGCATGTCGATATATATACTAAGCGAAGTATATTGGAGAACAACACATCCATTGTTGATGCACAACTATATATATTAATACATTGTAGCTCACATGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.60% 19.40% 0.00% 0.00% NA
All Indica  2759 71.70% 28.30% 0.00% 0.00% NA
All Japonica  1512 97.60% 2.40% 0.00% 0.00% NA
Aus  269 85.90% 14.10% 0.00% 0.00% NA
Indica I  595 59.20% 40.80% 0.00% 0.00% NA
Indica II  465 84.50% 15.50% 0.00% 0.00% NA
Indica III  913 70.30% 29.70% 0.00% 0.00% NA
Indica Intermediate  786 75.20% 24.80% 0.00% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 95.00% 5.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 44.80% 55.20% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0115342747 T -> C LOC_Os01g27480.1 upstream_gene_variant ; 1633.0bp to feature; MODIFIER silent_mutation Average:64.117; most accessible tissue: Zhenshan97 flower, score: 81.46 N N N N
vg0115342747 T -> C LOC_Os01g27490.1 downstream_gene_variant ; 3602.0bp to feature; MODIFIER silent_mutation Average:64.117; most accessible tissue: Zhenshan97 flower, score: 81.46 N N N N
vg0115342747 T -> C LOC_Os01g27470-LOC_Os01g27480 intergenic_region ; MODIFIER silent_mutation Average:64.117; most accessible tissue: Zhenshan97 flower, score: 81.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0115342747 2.00E-06 NA mr1519 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115342747 NA 2.40E-07 mr1519 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115342747 NA 3.37E-06 mr1519 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115342747 NA 7.75E-06 mr1719 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115342747 NA 2.34E-07 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115342747 NA 7.97E-06 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115342747 NA 6.38E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115342747 NA 7.30E-07 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115342747 1.83E-09 8.60E-45 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115342747 NA 6.04E-09 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115342747 4.76E-06 3.47E-10 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115342747 NA 2.09E-07 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251