Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115333877:

Variant ID: vg0115333877 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 15333877
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAAGTTTACTTTAATATTAAATTAAGAGGATGCTTATAGAGATGATTAAGATAGAATATACCCTATATGAGTTAATTTATTTGTTCACTTTCATGTTCA[T/G]
GACATGTCTTCAGATGGATGACCAAATTAGTTTTGTGAGGCTTGACATTAACCATGTTGATATATTTTAAGGTGTACGGTTCCTATTTTAACTTCCTCTA

Reverse complement sequence

TAGAGGAAGTTAAAATAGGAACCGTACACCTTAAAATATATCAACATGGTTAATGTCAAGCCTCACAAAACTAATTTGGTCATCCATCTGAAGACATGTC[A/C]
TGAACATGAAAGTGAACAAATAAATTAACTCATATAGGGTATATTCTATCTTAATCATCTCTATAAGCATCCTCTTAATTTAATATTAAAGTAAACTTAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.90%	15.00%	5.01%	10.07%	NA
All Indica	2759	60.20%	21.20%	7.90%	10.69%	NA
All Japonica	1512	85.90%	2.30%	0.46%	11.31%	NA
Aus	269	85.10%	11.50%	2.23%	1.12%	NA
Indica I	595	33.60%	33.10%	14.45%	18.82%	NA
Indica II	465	81.70%	4.70%	4.09%	9.46%	NA
Indica III	913	63.30%	23.90%	5.15%	7.67%	NA
Indica Intermediate	786	63.90%	19.00%	8.40%	8.78%	NA
Temperate Japonica	767	94.30%	0.80%	0.13%	4.82%	NA
Tropical Japonica	504	89.30%	5.00%	0.60%	5.16%	NA
Japonica Intermediate	241	52.30%	1.70%	1.24%	44.81%	NA
VI/Aromatic	96	43.80%	55.20%	1.04%	0.00%	NA
Intermediate	90	80.00%	6.70%	5.56%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0115333877	T -> G	LOC_Os01g27449.1	upstream_gene_variant ; 930.0bp to feature; MODIFIER	silent_mutation	Average:41.037; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0115333877	T -> G	LOC_Os01g27470.1	upstream_gene_variant ; 2653.0bp to feature; MODIFIER	silent_mutation	Average:41.037; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0115333877	T -> G	LOC_Os01g27449-LOC_Os01g27470	intergenic_region ; MODIFIER	silent_mutation	Average:41.037; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0115333877	T -> DEL	N	N	silent_mutation	Average:41.037; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0115333877	NA	7.27E-08	mr1519	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115333877	NA	1.44E-06	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115333877	NA	9.52E-07	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115333877	NA	3.97E-08	mr1105_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115333877	NA	3.24E-08	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115333877	4.65E-08	NA	mr1519_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115333877	3.15E-06	1.26E-15	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115333877	NA	3.82E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115333877	NA	7.67E-08	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115333877	NA	3.62E-06	mr1901_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251