\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115284393:

Variant ID: vg0115284393 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 15284393
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGTGGAGGAGTTCGGGGCCACGGCGCCGCCCAACTCCGACGAACTGGAGCTCGCGAGGGCGAGGTGGCTGAAGCTGCACGACTGTAAGTGCAGCTCCCG[G/A]
CACTGCGCCCACGAGAACTCCAGCTCGTCGGAGACGGGCGGTGCCGCGGCCTTGAACTCCTCCACGAGCCCATGCGCAGGGTCTGCGTCAGTGCCCGGAT

Reverse complement sequence

ATCCGGGCACTGACGCAGACCCTGCGCATGGGCTCGTGGAGGAGTTCAAGGCCGCGGCACCGCCCGTCTCCGACGAGCTGGAGTTCTCGTGGGCGCAGTG[C/T]
CGGGAGCTGCACTTACAGTCGTGCAGCTTCAGCCACCTCGCCCTCGCGAGCTCCAGTTCGTCGGAGTTGGGCGGCGCCGTGGCCCCGAACTCCTCCACGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.80% 16.40% 1.57% 11.26% NA
All Indica  2759 57.50% 25.30% 1.99% 15.22% NA
All Japonica  1512 90.10% 2.30% 0.73% 6.88% NA
Aus  269 83.60% 14.10% 1.86% 0.37% NA
Indica I  595 31.80% 40.20% 2.02% 26.05% NA
Indica II  465 75.70% 4.10% 2.80% 17.42% NA
Indica III  913 65.00% 29.20% 0.77% 5.04% NA
Indica Intermediate  786 57.60% 21.90% 2.93% 17.56% NA
Temperate Japonica  767 95.20% 0.90% 0.26% 3.65% NA
Tropical Japonica  504 91.10% 5.00% 0.60% 3.37% NA
Japonica Intermediate  241 71.80% 1.20% 2.49% 24.48% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 84.40% 4.40% 3.33% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0115284393 G -> A LOC_Os01g27370.1 synonymous_variant ; p.Cys106Cys; LOW synonymous_codon Average:88.432; most accessible tissue: Minghui63 panicle, score: 97.671 N N N N
vg0115284393 G -> DEL LOC_Os01g27370.1 N frameshift_variant Average:88.432; most accessible tissue: Minghui63 panicle, score: 97.671 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0115284393 G A -0.22 -0.16 -0.15 -0.12 -0.18 -0.18

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0115284393 NA 1.80E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115284393 2.59E-07 NA mr1519 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115284393 5.34E-06 3.67E-08 mr1519 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115284393 NA 1.40E-07 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115284393 NA 9.29E-07 mr1105_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115284393 NA 3.90E-07 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115284393 2.19E-11 NA mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115284393 4.45E-10 3.94E-18 mr1519_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115284393 NA 1.28E-07 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251