\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115241228:

Variant ID: vg0115241228 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 15241228
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTTCACAACCGAAACTCGTGAACCGGTCCTTAATTGTCATGAGCACGACTCTCAAAACCATGTGCTCACAACCCACCATTATCAGGTTTTAGTTGGCAT[A/G]
TGATTAATTAACCAATCACGATTGACCATCGTGAACTATCATTAAGCCATCATTAAACAATAGTGAGTCAAAAGTTATCCCAATAGTGTGCTAATGTTTC

Reverse complement sequence

GAAACATTAGCACACTATTGGGATAACTTTTGACTCACTATTGTTTAATGATGGCTTAATGATAGTTCACGATGGTCAATCGTGATTGGTTAATTAATCA[T/C]
ATGCCAACTAAAACCTGATAATGGTGGGTTGTGAGCACATGGTTTTGAGAGTCGTGCTCATGACAATTAAGGACCGGTTCACGAGTTTCGGTTGTGAAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 15.50% 14.30% 34.98% 35.15% NA
All Indica  2759 0.90% 0.90% 48.82% 49.33% NA
All Japonica  1512 39.50% 41.40% 8.13% 10.98% NA
Aus  269 22.30% 1.10% 54.28% 22.30% NA
Indica I  595 0.30% 0.70% 29.75% 69.24% NA
Indica II  465 1.30% 2.20% 39.57% 56.99% NA
Indica III  913 0.30% 0.10% 68.57% 31.00% NA
Indica Intermediate  786 1.80% 1.40% 45.80% 51.02% NA
Temperate Japonica  767 15.90% 71.70% 7.17% 5.22% NA
Tropical Japonica  504 83.90% 2.80% 5.75% 7.54% NA
Japonica Intermediate  241 21.60% 25.70% 16.18% 36.51% NA
VI/Aromatic  96 33.30% 2.10% 9.38% 55.21% NA
Intermediate  90 22.20% 23.30% 31.11% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0115241228 A -> G LOC_Os01g27320.1 downstream_gene_variant ; 4226.0bp to feature; MODIFIER silent_mutation Average:6.914; most accessible tissue: Zhenshan97 flag leaf, score: 10.769 N N N N
vg0115241228 A -> G LOC_Os01g27300-LOC_Os01g27320 intergenic_region ; MODIFIER silent_mutation Average:6.914; most accessible tissue: Zhenshan97 flag leaf, score: 10.769 N N N N
vg0115241228 A -> DEL N N silent_mutation Average:6.914; most accessible tissue: Zhenshan97 flag leaf, score: 10.769 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0115241228 NA 1.84E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115241228 NA 1.43E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115241228 2.59E-06 2.59E-06 mr1193 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115241228 NA 1.61E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115241228 NA 2.54E-06 mr1269 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115241228 NA 1.08E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115241228 NA 2.60E-09 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115241228 NA 1.58E-06 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115241228 NA 5.82E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115241228 NA 5.58E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115241228 NA 1.70E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115241228 NA 7.85E-07 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115241228 NA 2.83E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115241228 NA 6.36E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115241228 NA 2.72E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115241228 NA 7.02E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115241228 NA 2.81E-13 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115241228 NA 5.52E-09 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115241228 NA 2.34E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115241228 1.22E-06 7.56E-08 mr1991 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115241228 NA 3.90E-06 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115241228 NA 5.90E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251