\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115235371:

Variant ID: vg0115235371 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 15235371
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAAATACAAAAAGGGTGATACATAGGCAAAATACTTTATATTGAAATGGAGATAGTACACTATTTCTCTATAAACTTGTCTAAATTTATAGAAGTTTGA[T/C]
AGAAATAAAGTCAAAGCGTTTTATAATATAAAATGAAGGGAATAGAAATAGGTCAGCAGTTACATTATATTTTAGCATCTATCCTATTTCTTAAATTTTG

Reverse complement sequence

CAAAATTTAAGAAATAGGATAGATGCTAAAATATAATGTAACTGCTGACCTATTTCTATTCCCTTCATTTTATATTATAAAACGCTTTGACTTTATTTCT[A/G]
TCAAACTTCTATAAATTTAGACAAGTTTATAGAGAAATAGTGTACTATCTCCATTTCAATATAAAGTATTTTGCCTATGTATCACCCTTTTTGTATTTTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.60% 9.20% 0.49% 42.66% NA
All Indica  2759 26.30% 11.50% 0.83% 61.40% NA
All Japonica  1512 85.40% 0.10% 0.00% 14.48% NA
Aus  269 28.30% 41.60% 0.00% 30.11% NA
Indica I  595 4.20% 4.70% 0.50% 90.59% NA
Indica II  465 57.20% 3.90% 0.86% 38.06% NA
Indica III  913 25.30% 19.70% 0.88% 54.11% NA
Indica Intermediate  786 26.00% 11.50% 1.02% 61.58% NA
Temperate Japonica  767 94.30% 0.00% 0.00% 5.74% NA
Tropical Japonica  504 88.90% 0.00% 0.00% 11.11% NA
Japonica Intermediate  241 50.20% 0.40% 0.00% 49.38% NA
VI/Aromatic  96 95.80% 3.10% 0.00% 1.04% NA
Intermediate  90 71.10% 5.60% 0.00% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0115235371 T -> DEL N N silent_mutation Average:24.506; most accessible tissue: Zhenshan97 young leaf, score: 50.669 N N N N
vg0115235371 T -> C LOC_Os01g27300.1 downstream_gene_variant ; 678.0bp to feature; MODIFIER silent_mutation Average:24.506; most accessible tissue: Zhenshan97 young leaf, score: 50.669 N N N N
vg0115235371 T -> C LOC_Os01g27300-LOC_Os01g27320 intergenic_region ; MODIFIER silent_mutation Average:24.506; most accessible tissue: Zhenshan97 young leaf, score: 50.669 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0115235371 NA 9.43E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115235371 NA 7.72E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115235371 1.88E-06 1.88E-06 mr1249 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115235371 NA 5.50E-08 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115235371 NA 2.64E-06 mr1741 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115235371 NA 9.96E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251