\
| Variant ID: vg0115235371 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 15235371 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CAAAATACAAAAAGGGTGATACATAGGCAAAATACTTTATATTGAAATGGAGATAGTACACTATTTCTCTATAAACTTGTCTAAATTTATAGAAGTTTGA[T/C]
AGAAATAAAGTCAAAGCGTTTTATAATATAAAATGAAGGGAATAGAAATAGGTCAGCAGTTACATTATATTTTAGCATCTATCCTATTTCTTAAATTTTG
CAAAATTTAAGAAATAGGATAGATGCTAAAATATAATGTAACTGCTGACCTATTTCTATTCCCTTCATTTTATATTATAAAACGCTTTGACTTTATTTCT[A/G]
TCAAACTTCTATAAATTTAGACAAGTTTATAGAGAAATAGTGTACTATCTCCATTTCAATATAAAGTATTTTGCCTATGTATCACCCTTTTTGTATTTTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.60% | 9.20% | 0.49% | 42.66% | NA |
| All Indica | 2759 | 26.30% | 11.50% | 0.83% | 61.40% | NA |
| All Japonica | 1512 | 85.40% | 0.10% | 0.00% | 14.48% | NA |
| Aus | 269 | 28.30% | 41.60% | 0.00% | 30.11% | NA |
| Indica I | 595 | 4.20% | 4.70% | 0.50% | 90.59% | NA |
| Indica II | 465 | 57.20% | 3.90% | 0.86% | 38.06% | NA |
| Indica III | 913 | 25.30% | 19.70% | 0.88% | 54.11% | NA |
| Indica Intermediate | 786 | 26.00% | 11.50% | 1.02% | 61.58% | NA |
| Temperate Japonica | 767 | 94.30% | 0.00% | 0.00% | 5.74% | NA |
| Tropical Japonica | 504 | 88.90% | 0.00% | 0.00% | 11.11% | NA |
| Japonica Intermediate | 241 | 50.20% | 0.40% | 0.00% | 49.38% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 71.10% | 5.60% | 0.00% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0115235371 | T -> DEL | N | N | silent_mutation | Average:24.506; most accessible tissue: Zhenshan97 young leaf, score: 50.669 | N | N | N | N |
| vg0115235371 | T -> C | LOC_Os01g27300.1 | downstream_gene_variant ; 678.0bp to feature; MODIFIER | silent_mutation | Average:24.506; most accessible tissue: Zhenshan97 young leaf, score: 50.669 | N | N | N | N |
| vg0115235371 | T -> C | LOC_Os01g27300-LOC_Os01g27320 | intergenic_region ; MODIFIER | silent_mutation | Average:24.506; most accessible tissue: Zhenshan97 young leaf, score: 50.669 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0115235371 | NA | 9.43E-06 | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115235371 | NA | 7.72E-06 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115235371 | 1.88E-06 | 1.88E-06 | mr1249 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115235371 | NA | 5.50E-08 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115235371 | NA | 2.64E-06 | mr1741 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115235371 | NA | 9.96E-06 | mr1128_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |