\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115227579:

Variant ID: vg0115227579 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 15227579
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTCAATGGTCAAGTTGTGGATCAAACAGATCATGCTATTATCATGCAGTTTTCTGCCAGAGTTAGCCCTGATACCTTTAATCTGGTTAATGTTTATGGG[C/A]
CATCTTCTGGCCCCCAAAGAGATGATTTTGTTCACTGGATGAATGGGCTAGACATATATTTGAATGAAAACTGGATCTTTACGGGTGATTTCAATTTTTA

Reverse complement sequence

TAAAAATTGAAATCACCCGTAAAGATCCAGTTTTCATTCAAATATATGTCTAGCCCATTCATCCAGTGAACAAAATCATCTCTTTGGGGGCCAGAAGATG[G/T]
CCCATAAACATTAACCAGATTAAAGGTATCAGGGCTAACTCTGGCAGAAAACTGCATGATAATAGCATGATCTGTTTGATCCACAACTTGACCATTGAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.90% 7.00% 10.77% 47.33% NA
All Indica  2759 3.80% 11.40% 17.00% 67.81% NA
All Japonica  1512 85.90% 0.00% 0.26% 13.82% NA
Aus  269 55.00% 4.50% 10.04% 30.48% NA
Indica I  595 3.00% 18.30% 20.17% 58.49% NA
Indica II  465 4.70% 16.80% 26.24% 52.26% NA
Indica III  913 2.00% 3.80% 10.08% 84.12% NA
Indica Intermediate  786 6.00% 11.70% 17.18% 65.14% NA
Temperate Japonica  767 95.00% 0.00% 0.26% 4.69% NA
Tropical Japonica  504 89.30% 0.00% 0.00% 10.71% NA
Japonica Intermediate  241 49.80% 0.00% 0.83% 49.38% NA
VI/Aromatic  96 47.90% 0.00% 2.08% 50.00% NA
Intermediate  90 55.60% 6.70% 7.78% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0115227579 C -> A LOC_Os01g27280.1 missense_variant ; p.Pro570Thr; MODERATE nonsynonymous_codon ; P570T Average:11.145; most accessible tissue: Zhenshan97 young leaf, score: 30.745 unknown unknown TOLERATED 0.33
vg0115227579 C -> DEL LOC_Os01g27280.1 N frameshift_variant Average:11.145; most accessible tissue: Zhenshan97 young leaf, score: 30.745 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0115227579 NA 1.11E-09 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115227579 NA 1.62E-10 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115227579 NA 6.38E-10 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115227579 NA 2.63E-11 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115227579 NA 3.38E-10 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115227579 NA 7.79E-27 mr1877_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115227579 NA 1.42E-08 mr1877_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251