Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0115224388:

Variant ID: vg0115224388 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 15224388
Reference Allele: C	Alternative Allele: G,T
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATCCATGGAGTCCTCTGAGTGCATCCATGGTGACGCCAGCACCCCCAGGGGGTTGGGATTTCTCCTCTGGTGACCGTTTTCGTGATGAAGTCTTCTCCA[C/G,T]
GTTCTCTTCCCCGGTGCACTTTTCTCGTTTTTTTCTCTCGTCGTCCTTTTCGTCTTGTGGTCGATTTCCCCCGTTCTTCTTTTCGGTTGTGCACTTCTTC

Reverse complement sequence

GAAGAAGTGCACAACCGAAAAGAAGAACGGGGGAAATCGACCACAAGACGAAAAGGACGACGAGAGAAAAAAACGAGAAAAGTGCACCGGGGAAGAGAAC[G/C,A]
TGGAGAAGACTTCATCACGAAAACGGTCACCAGAGGAGAAATCCCAACCCCCTGGGGGTGCTGGCGTCACCATGGATGCACTCAGAGGACTCCATGGATC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.70%	0.40%	0.51%	66.31%	T: 0.02%
All Indica	2759	3.80%	0.20%	0.58%	95.47%	NA
All Japonica	1512	85.30%	0.30%	0.33%	14.09%	T: 0.07%
Aus	269	26.80%	0.00%	0.74%	72.49%	NA
Indica I	595	4.50%	0.00%	0.50%	94.96%	NA
Indica II	465	6.20%	0.00%	0.22%	93.55%	NA
Indica III	913	0.70%	0.10%	0.55%	98.69%	NA
Indica Intermediate	786	5.30%	0.50%	0.89%	93.26%	NA
Temperate Japonica	767	94.10%	0.40%	0.52%	4.95%	NA
Tropical Japonica	504	88.70%	0.20%	0.00%	10.91%	T: 0.20%
Japonica Intermediate	241	49.80%	0.00%	0.41%	49.79%	NA
VI/Aromatic	96	38.50%	9.40%	0.00%	52.08%	NA
Intermediate	90	48.90%	3.30%	1.11%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0115224388	C -> G	LOC_Os01g27270.1	downstream_gene_variant ; 2718.0bp to feature; MODIFIER	silent_mutation	Average:10.652; most accessible tissue: Callus, score: 40.013	N	N	N	N
vg0115224388	C -> G	LOC_Os01g27280.1	intron_variant ; MODIFIER	silent_mutation	Average:10.652; most accessible tissue: Callus, score: 40.013	N	N	N	N
vg0115224388	C -> T	LOC_Os01g27270.1	downstream_gene_variant ; 2718.0bp to feature; MODIFIER	silent_mutation	Average:10.652; most accessible tissue: Callus, score: 40.013	N	N	N	N
vg0115224388	C -> T	LOC_Os01g27280.1	intron_variant ; MODIFIER	silent_mutation	Average:10.652; most accessible tissue: Callus, score: 40.013	N	N	N	N
vg0115224388	C -> DEL	N	N	silent_mutation	Average:10.652; most accessible tissue: Callus, score: 40.013	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0115224388	6.41E-06	1.58E-57	mr1519	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115224388	NA	3.37E-06	mr1519	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115224388	NA	6.93E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115224388	NA	2.66E-21	mr1698	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115224388	NA	7.75E-06	mr1719	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115224388	NA	4.95E-16	mr1950	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115224388	NA	2.34E-07	mr1064_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115224388	NA	7.97E-06	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115224388	2.14E-13	4.39E-66	mr1519_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115224388	4.76E-06	3.47E-10	mr1519_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115224388	NA	8.38E-22	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115224388	NA	2.09E-07	mr1745_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251