\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115183271:

Variant ID: vg0115183271 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 15183271
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTACCACATGGGCCCAACAACCTAACCTAGCTCCGGTGGAGAAGTATTATAATCTTTGCATTAAATGCATGTCTTGTCTCTTGATTTGGGAAGCCAAGC[G/A,T]
CACGTCGTCTTGATGATGGGGCCTGTCAAACCTTGCCGCCTGACACGGGGGGTGCCCCTGTCAGTCACCATTTAATGGGTGAAGACTTCTGGGCTCCTAT

Reverse complement sequence

ATAGGAGCCCAGAAGTCTTCACCCATTAAATGGTGACTGACAGGGGCACCCCCCGTGTCAGGCGGCAAGGTTTGACAGGCCCCATCATCAAGACGACGTG[C/T,A]
GCTTGGCTTCCCAAATCAAGAGACAAGACATGCATTTAATGCAAAGATTATAATACTTCTCCACCGGAGCTAGGTTAGGTTGTTGGGCCCATGTGGTAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.60% 1.50% 9.50% 54.30% T: 0.06%
All Indica  2759 6.60% 2.50% 13.70% 77.09% T: 0.11%
All Japonica  1512 85.50% 0.10% 0.20% 14.22% NA
Aus  269 28.60% 0.00% 23.05% 48.33% NA
Indica I  595 5.20% 0.00% 8.91% 85.71% T: 0.17%
Indica II  465 10.80% 0.60% 11.40% 76.77% T: 0.43%
Indica III  913 3.80% 4.50% 19.39% 72.29% NA
Indica Intermediate  786 8.30% 3.30% 12.09% 76.34% NA
Temperate Japonica  767 94.40% 0.00% 0.26% 5.35% NA
Tropical Japonica  504 89.50% 0.00% 0.20% 10.32% NA
Japonica Intermediate  241 49.00% 0.40% 0.00% 50.62% NA
VI/Aromatic  96 36.50% 1.00% 2.08% 60.42% NA
Intermediate  90 54.40% 1.10% 4.44% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0115183271 G -> T LOC_Os01g27230.1 downstream_gene_variant ; 1805.0bp to feature; MODIFIER silent_mutation Average:22.149; most accessible tissue: Minghui63 young leaf, score: 38.036 N N N N
vg0115183271 G -> T LOC_Os01g27210-LOC_Os01g27230 intergenic_region ; MODIFIER silent_mutation Average:22.149; most accessible tissue: Minghui63 young leaf, score: 38.036 N N N N
vg0115183271 G -> A LOC_Os01g27230.1 downstream_gene_variant ; 1805.0bp to feature; MODIFIER silent_mutation Average:22.149; most accessible tissue: Minghui63 young leaf, score: 38.036 N N N N
vg0115183271 G -> A LOC_Os01g27210-LOC_Os01g27230 intergenic_region ; MODIFIER silent_mutation Average:22.149; most accessible tissue: Minghui63 young leaf, score: 38.036 N N N N
vg0115183271 G -> DEL N N silent_mutation Average:22.149; most accessible tissue: Minghui63 young leaf, score: 38.036 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0115183271 NA 8.80E-06 mr1283_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115183271 NA 3.10E-06 mr1823_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115183271 NA 7.23E-06 mr1824_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115183271 NA 6.71E-06 mr1856_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115183271 2.66E-06 8.70E-07 mr1915_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251