\
| Variant ID: vg0115183271 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 15183271 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTTACCACATGGGCCCAACAACCTAACCTAGCTCCGGTGGAGAAGTATTATAATCTTTGCATTAAATGCATGTCTTGTCTCTTGATTTGGGAAGCCAAGC[G/A,T]
CACGTCGTCTTGATGATGGGGCCTGTCAAACCTTGCCGCCTGACACGGGGGGTGCCCCTGTCAGTCACCATTTAATGGGTGAAGACTTCTGGGCTCCTAT
ATAGGAGCCCAGAAGTCTTCACCCATTAAATGGTGACTGACAGGGGCACCCCCCGTGTCAGGCGGCAAGGTTTGACAGGCCCCATCATCAAGACGACGTG[C/T,A]
GCTTGGCTTCCCAAATCAAGAGACAAGACATGCATTTAATGCAAAGATTATAATACTTCTCCACCGGAGCTAGGTTAGGTTGTTGGGCCCATGTGGTAAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.60% | 1.50% | 9.50% | 54.30% | T: 0.06% |
| All Indica | 2759 | 6.60% | 2.50% | 13.70% | 77.09% | T: 0.11% |
| All Japonica | 1512 | 85.50% | 0.10% | 0.20% | 14.22% | NA |
| Aus | 269 | 28.60% | 0.00% | 23.05% | 48.33% | NA |
| Indica I | 595 | 5.20% | 0.00% | 8.91% | 85.71% | T: 0.17% |
| Indica II | 465 | 10.80% | 0.60% | 11.40% | 76.77% | T: 0.43% |
| Indica III | 913 | 3.80% | 4.50% | 19.39% | 72.29% | NA |
| Indica Intermediate | 786 | 8.30% | 3.30% | 12.09% | 76.34% | NA |
| Temperate Japonica | 767 | 94.40% | 0.00% | 0.26% | 5.35% | NA |
| Tropical Japonica | 504 | 89.50% | 0.00% | 0.20% | 10.32% | NA |
| Japonica Intermediate | 241 | 49.00% | 0.40% | 0.00% | 50.62% | NA |
| VI/Aromatic | 96 | 36.50% | 1.00% | 2.08% | 60.42% | NA |
| Intermediate | 90 | 54.40% | 1.10% | 4.44% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0115183271 | G -> T | LOC_Os01g27230.1 | downstream_gene_variant ; 1805.0bp to feature; MODIFIER | silent_mutation | Average:22.149; most accessible tissue: Minghui63 young leaf, score: 38.036 | N | N | N | N |
| vg0115183271 | G -> T | LOC_Os01g27210-LOC_Os01g27230 | intergenic_region ; MODIFIER | silent_mutation | Average:22.149; most accessible tissue: Minghui63 young leaf, score: 38.036 | N | N | N | N |
| vg0115183271 | G -> A | LOC_Os01g27230.1 | downstream_gene_variant ; 1805.0bp to feature; MODIFIER | silent_mutation | Average:22.149; most accessible tissue: Minghui63 young leaf, score: 38.036 | N | N | N | N |
| vg0115183271 | G -> A | LOC_Os01g27210-LOC_Os01g27230 | intergenic_region ; MODIFIER | silent_mutation | Average:22.149; most accessible tissue: Minghui63 young leaf, score: 38.036 | N | N | N | N |
| vg0115183271 | G -> DEL | N | N | silent_mutation | Average:22.149; most accessible tissue: Minghui63 young leaf, score: 38.036 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0115183271 | NA | 8.80E-06 | mr1283_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115183271 | NA | 3.10E-06 | mr1823_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115183271 | NA | 7.23E-06 | mr1824_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115183271 | NA | 6.71E-06 | mr1856_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115183271 | 2.66E-06 | 8.70E-07 | mr1915_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |