\
| Variant ID: vg0115147411 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 15147411 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, T: 0.30, others allele: 0.00, population size: 241. )
GATGGCATTTTGACGCTTATTTAATTTGGTTCATTTTTTTTTCTGCTCCTGTGTTGCAACCTGCATGTTATTGGTGTCCTCCTGTGTATTTCCTGAATGA[G/T]
TTCTTGGAGATGGATATGTATGCCTTATTTATGATAATTGTTTGCAGTGAAGCATGTTAATTAGATTGATTCTGTACTTTCAGTGCGAGGCACATTTGTT
AACAAATGTGCCTCGCACTGAAAGTACAGAATCAATCTAATTAACATGCTTCACTGCAAACAATTATCATAAATAAGGCATACATATCCATCTCCAAGAA[C/A]
TCATTCAGGAAATACACAGGAGGACACCAATAACATGCAGGTTGCAACACAGGAGCAGAAAAAAAAATGAACCAAATTAAATAAGCGTCAAAATGCCATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.60% | 20.40% | 0.04% | 0.04% | NA |
| All Indica | 2759 | 74.40% | 25.50% | 0.07% | 0.07% | NA |
| All Japonica | 1512 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 85.50% | 14.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 60.00% | 39.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 95.50% | 4.30% | 0.00% | 0.22% | NA |
| Indica III | 913 | 70.30% | 29.60% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 77.50% | 22.40% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 89.10% | 10.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 53.10% | 46.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0115147411 | G -> T | LOC_Os01g27170.1 | downstream_gene_variant ; 4549.0bp to feature; MODIFIER | silent_mutation | Average:36.792; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0115147411 | G -> T | LOC_Os01g27160.1 | intron_variant ; MODIFIER | silent_mutation | Average:36.792; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0115147411 | G -> DEL | N | N | silent_mutation | Average:36.792; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0115147411 | 5.15E-10 | NA | mr1519 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115147411 | 1.29E-08 | 2.99E-11 | mr1519 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115147411 | NA | 3.37E-06 | mr1519 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115147411 | NA | 7.90E-06 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115147411 | NA | 7.75E-06 | mr1719 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115147411 | NA | 2.34E-07 | mr1064_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115147411 | NA | 3.19E-06 | mr1105_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115147411 | NA | 7.97E-06 | mr1113_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115147411 | NA | 5.72E-07 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115147411 | 2.63E-17 | NA | mr1519_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115147411 | 3.61E-15 | 1.77E-24 | mr1519_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115147411 | 4.76E-06 | 3.47E-10 | mr1519_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115147411 | NA | 2.09E-07 | mr1745_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |