\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115129673:

Variant ID: vg0115129673 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 15129673
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCTTCTTCCGCTACACAGCGCGTCGAGTGGTAACGATCTATGATCTAATACTTGCATGGTTCCTAGTTTACGTGATAGAAAATTTTGATTTATGCTATC[G/A]
TAGTCTACGCGTATCCCGACACTTTTGGCTTATCATCCTTTTGCGTCCGGCAAATTGTGTCGCCCTGGATCTGCTTCGCCTTTACCAAGTCACTCCTTTG

Reverse complement sequence

CAAAGGAGTGACTTGGTAAAGGCGAAGCAGATCCAGGGCGACACAATTTGCCGGACGCAAAAGGATGATAAGCCAAAAGTGTCGGGATACGCGTAGACTA[C/T]
GATAGCATAAATCAAAATTTTCTATCACGTAAACTAGGAACCATGCAAGTATTAGATCATAGATCGTTACCACTCGACGCGCTGTGTAGCGGAAGAAGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.60% 6.30% 1.06% 8.04% NA
All Indica  2759 79.70% 6.90% 1.59% 11.89% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 44.20% 37.50% 1.49% 16.73% NA
Indica I  595 90.10% 2.90% 1.85% 5.21% NA
Indica II  465 92.00% 3.20% 0.22% 4.52% NA
Indica III  913 73.50% 10.10% 1.53% 14.90% NA
Indica Intermediate  786 71.60% 8.30% 2.29% 17.81% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 3.10% 0.00% 1.04% NA
Intermediate  90 86.70% 4.40% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0115129673 G -> A LOC_Os01g27140.1 downstream_gene_variant ; 4275.0bp to feature; MODIFIER silent_mutation Average:40.244; most accessible tissue: Zhenshan97 flower, score: 81.724 N N N N
vg0115129673 G -> A LOC_Os01g27150.1 downstream_gene_variant ; 1184.0bp to feature; MODIFIER silent_mutation Average:40.244; most accessible tissue: Zhenshan97 flower, score: 81.724 N N N N
vg0115129673 G -> A LOC_Os01g27150.2 downstream_gene_variant ; 1184.0bp to feature; MODIFIER silent_mutation Average:40.244; most accessible tissue: Zhenshan97 flower, score: 81.724 N N N N
vg0115129673 G -> A LOC_Os01g27140-LOC_Os01g27150 intergenic_region ; MODIFIER silent_mutation Average:40.244; most accessible tissue: Zhenshan97 flower, score: 81.724 N N N N
vg0115129673 G -> DEL N N silent_mutation Average:40.244; most accessible tissue: Zhenshan97 flower, score: 81.724 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0115129673 NA 1.78E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673 NA 2.84E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673 4.41E-06 4.41E-06 mr1151 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673 NA 1.06E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673 9.81E-06 9.81E-06 mr1249 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673 NA 5.52E-06 mr1636 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673 NA 2.54E-09 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673 NA 1.26E-11 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673 NA 3.70E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673 NA 2.35E-06 mr1759 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673 3.67E-06 3.66E-06 mr1985 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673 NA 9.18E-09 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673 NA 9.44E-07 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251