Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115129673:

Variant ID: vg0115129673 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 15129673
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCTTCTTCCGCTACACAGCGCGTCGAGTGGTAACGATCTATGATCTAATACTTGCATGGTTCCTAGTTTACGTGATAGAAAATTTTGATTTATGCTATC[G/A]
TAGTCTACGCGTATCCCGACACTTTTGGCTTATCATCCTTTTGCGTCCGGCAAATTGTGTCGCCCTGGATCTGCTTCGCCTTTACCAAGTCACTCCTTTG

Reverse complement sequence

CAAAGGAGTGACTTGGTAAAGGCGAAGCAGATCCAGGGCGACACAATTTGCCGGACGCAAAAGGATGATAAGCCAAAAGTGTCGGGATACGCGTAGACTA[C/T]
GATAGCATAAATCAAAATTTTCTATCACGTAAACTAGGAACCATGCAAGTATTAGATCATAGATCGTTACCACTCGACGCGCTGTGTAGCGGAAGAAGGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.60%	6.30%	1.06%	8.04%	NA
All Indica	2759	79.70%	6.90%	1.59%	11.89%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	44.20%	37.50%	1.49%	16.73%	NA
Indica I	595	90.10%	2.90%	1.85%	5.21%	NA
Indica II	465	92.00%	3.20%	0.22%	4.52%	NA
Indica III	913	73.50%	10.10%	1.53%	14.90%	NA
Indica Intermediate	786	71.60%	8.30%	2.29%	17.81%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	3.10%	0.00%	1.04%	NA
Intermediate	90	86.70%	4.40%	2.22%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0115129673	G -> A	LOC_Os01g27140.1	downstream_gene_variant ; 4275.0bp to feature; MODIFIER	silent_mutation	Average:40.244; most accessible tissue: Zhenshan97 flower, score: 81.724	N	N	N	N
vg0115129673	G -> A	LOC_Os01g27150.1	downstream_gene_variant ; 1184.0bp to feature; MODIFIER	silent_mutation	Average:40.244; most accessible tissue: Zhenshan97 flower, score: 81.724	N	N	N	N
vg0115129673	G -> A	LOC_Os01g27150.2	downstream_gene_variant ; 1184.0bp to feature; MODIFIER	silent_mutation	Average:40.244; most accessible tissue: Zhenshan97 flower, score: 81.724	N	N	N	N
vg0115129673	G -> A	LOC_Os01g27140-LOC_Os01g27150	intergenic_region ; MODIFIER	silent_mutation	Average:40.244; most accessible tissue: Zhenshan97 flower, score: 81.724	N	N	N	N
vg0115129673	G -> DEL	N	N	silent_mutation	Average:40.244; most accessible tissue: Zhenshan97 flower, score: 81.724	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0115129673	NA	1.78E-06	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673	NA	2.84E-06	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673	4.41E-06	4.41E-06	mr1151	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673	NA	1.06E-06	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673	9.81E-06	9.81E-06	mr1249	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673	NA	5.52E-06	mr1636	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673	NA	2.54E-09	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673	NA	1.26E-11	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673	NA	3.70E-06	mr1740	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673	NA	2.35E-06	mr1759	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673	3.67E-06	3.66E-06	mr1985	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673	NA	9.18E-09	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115129673	NA	9.44E-07	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251